Đột biến gen H-ras trong ung thư hốc miệng

Mục tiêu: Phân tích sự liên quan giữa đột biến gen H-ras với đột biến gen p53, biểu hiện các protein p53, MDM2 và Ki-67 trong ung thư hốc miệng. Phương pháp: Thực hiện nghiên cứu cắt ngang trong 18 ca ung thư tế bào gai ở hốc miệng bằng cách tiến hành giải trình tự chuỗi DNA tại các exon 1 và 2 của gen H-ras và nhuộm hóa miễn dịch khảo sát biểu hiện protein p53, MDM2 và Ki-67. Kết quả: Phát hiện 3 ca có đột biến H-ras, chiếm tỉ lệ 16,7%, gồm có 1 đột biến thêm 3 nucleotid (GGC) giữa codon 10 và codon 11 tạo ra thêm glycin (10Gly11) trong khung, 1 đột biến điểm tại codon 12 (GGC>AGC) và 1 đột biến điểm tại codon 13 (GGT>CGT) làm thay đổi axít amin. Ngoài ra, có 5 đột biến im lặng (27,8%) biểu hiện đa hình nucleotid đơn C81T. Đối chiếu với 8 ca trước đây đã phát hiện có đột biến gen p53 cho thấy 4 ca (22,2%) cùng có đột biến trên cả hai gen p53 và H-ras, tuy nhiên chỉ có đột biến p53 sai nghĩa hay ghép nối sai còn đột biến H-ras im lặng. Đột biến H-ras liên quan với thói quen nhai trầu và biểu hiện quá mức protein MDM2 (P < 0,05), nhưng không liên quan với biểu hiện protein p53 và Ki-67 (P > 0,05). Kết luận: Đột biến H-ras có thể phối hợp với biến đổi protein MDM2 tham gia vào quá trình sinh ung thư hốc miệng ở người Việt Nam có thói quen nhai trầu-xỉa thuốc. Đột biến H-ras và đột biến p53 độc lập và loại trừ lẫn nhau.

pdf7 trang | Chia sẻ: thuyduongbt11 | Ngày: 11/06/2022 | Lượt xem: 278 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Đột biến gen H-ras trong ung thư hốc miệng, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 36 ĐỘT BIẾN GEN H-RAS TRONG UNG THƯ HỐC MIỆNG Nguyễn Thị Hồng* TÓM TẮT Mục tiêu: Phân tích sự liên quan giữa đột biến gen H-ras với đột biến gen p53, biểu hiện các protein p53, MDM2 và Ki-67 trong ung thư hốc miệng. Phương pháp: Thực hiện nghiên cứu cắt ngang trong 18 ca ung thư tế bào gai ở hốc miệng bằng cách tiến hành giải trình tự chuỗi DNA tại các exon 1 và 2 của gen H-ras và nhuộm hóa miễn dịch khảo sát biểu hiện protein p53, MDM2 và Ki-67. Kết quả: Phát hiện 3 ca có đột biến H-ras, chiếm tỉ lệ 16,7%, gồm có 1 đột biến thêm 3 nucleotid (GGC) giữa codon 10 và codon 11 tạo ra thêm glycin (10Gly11) trong khung, 1 đột biến điểm tại codon 12 (GGC>AGC) và 1 đột biến điểm tại codon 13 (GGT>CGT) làm thay đổi axít amin. Ngoài ra, có 5 đột biến im lặng (27,8%) biểu hiện đa hình nucleotid đơn C81T. Đối chiếu với 8 ca trước đây đã phát hiện có đột biến gen p53 cho thấy 4 ca (22,2%) cùng có đột biến trên cả hai gen p53 và H-ras, tuy nhiên chỉ có đột biến p53 sai nghĩa hay ghép nối sai còn đột biến H-ras im lặng. Đột biến H-ras liên quan với thói quen nhai trầu và biểu hiện quá mức protein MDM2 (P 0,05). Kết luận: Đột biến H-ras có thể phối hợp với biến đổi protein MDM2 tham gia vào quá trình sinh ung thư hốc miệng ở người Việt Nam có thói quen nhai trầu-xỉa thuốc. Đột biến H-ras và đột biến p53 độc lập và loại trừ lẫn nhau. Từ khóa: Đột biến H-ras, đột biến p53, biểu hiện quá mức, MDM2, Ki-67, ung thư hốc miệng. ABSTRACT H-RAS GENE MUTATION IN ORAL CANCER Nguyen Thi Hong * Y Hoc TP. Ho Chi Minh * Vol. 15 - Supplement of No 2 - 2011: 36 - 42 Objectives: To investigate the correlation between H-ras gene mutation and p53 gene mutation, p53, MDM2, and Ki-67 expression in oral carcinoma. Methods: In this cross-sectional study, DNA samples obtained from the same 18 primary oral squamous cell carcinomas were screened for mutations of hot spots in exons 1 and 2 of the H-ras gene by DNA sequencing. Formalin-fixed paraffin-embedded tissues were stained by immunohistochemistry for p53, MDM2 and Ki-67 proteins. Results: H-ras mutations were detected in 3 cases (16.7%), including one insertion of three nucleotide (GGC) between codons 10 and 11 resulting in in-frame insertion of glycine (10Gly11), one missense point mutation in codon 12 (GGC>AGC) and one missense point mutation in codon 13 (GGT>CGT) resulting in amino acid changes. Silent mutations with C81T single nucleotide polymorphism (SNP) were found in 5 of 18 tumors (27.8%). Compared to p53 mutation previously detected in 8 cases, 4 cases (22.2%) had simultaneously H-ras mutation (silent mutation) and p53 mutation (missense or aberrant splicing mutation). H-ras mutation showed significant association with the betel chewing habit and MDM2 expression (P < 0.05), but not with p53 and Ki-67 expression (P > 0.05). * Khoa Răng Hàm Mặt – Đại học Y Dược TP. Hồ Chí Minh Tác giả liên lạc: TS.BS. Nguyễn Thị Hồng Email: nguyopat@hcm.vnn.vn Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 37 Conclusion: H-ras mutation can be associated with MDM2 alteration in the tumorigenesis of betel and tobacco-related oral carcinoma in Vietnamese patients. H-ras mutation and p53 mutation are independent and mutually exclusive. Key words: H-ras mutation, p53 mutation, overexpression, MDM2, Ki-67, oral carcinoma. ĐẶT VẤN ĐỀ Đột biến gen đè nén bướu p53 phổ biến nhất, chiếm hơn 50% các loại ung thư ở người(12). Tỉ lệ đột biến gen p53 trong ung thư hốc miệng (UTHM) ở người Việt Nam là 44,4%(6). Nhiều trường hợp không có đột biến ở gen p53 gợi ra khả năng đột biến ở gen khác. Trong các oncogen, gen ras thường bị đột biến nhất(10,11). Khoảng 30% ung thư ở người có đột biến gen này(10). Họ gen ras, gồm có 3 gen là H-ras, K-ras và N-ras, mã hóa protein p21(12) định vị ở màng tế bào và giữ vai trò trung tâm điều hòa các đường dẫn truyền tín hiệu tăng trưởng tế bào. Đường dẫn truyền tín hiệu EGFR–Ras– Raf–MEK–ERK hiện đang là điểm đích hấp dẫn cho điều trị ung thư(10). Trong UTHM, đa số đột biến chỉ tìm thấy ở gen H-ras mà rất ít khi ở gen K-ras và N-ras(10). Bất hoạt gen đè nén bướu hoặc hoạt hóa oncogen có thể làm mất kiểm soát chu trình tế bào khiến cho tế bào sinh sản liên tục. Protein Ki-67 được xem là chất đánh dấu về sự sinh sản tế bào. Mặt khác, biểu hiện quá mức protein p53 có thể do đột biến gen p53 hoặc do bất thường protein MDM2 - là protein gắn và phân hủy protein p53. Trong UTHM ở những nước có thói quen nhai trầu, đột biến oncogen H-ras và biểu hiện quá mức protein MDM2 khá phổ biến(10). Do vậy, chúng tôi thực hiện nghiên cứu này nhằm khảo sát đột biến gen H-ras, phân tích sự liên quan giữa đột biến gen H-ras với một số đặc điểm lâm sàng-giải phẫu bệnh, và với đột biến gen p53, biểu hiện các protein p53, MDM2 và Ki-67 trong UTHM. ĐỐI TƯỢNG - PHƯƠNG PHÁP NGHIÊN CỨU Mẫu nghiên cứu 18 ca ung thư tế bào gai ở hốc miệng chưa điều trị đặc hiệu, được điều trị tại Bệnh viện Ung Bướu Tp.HCM tháng 7 và 8 năm 2000. Thiết kế nghiên cứu Cắt ngang mô tả. Các phương pháp thực hiện Khám lâm sàng và sinh thiết bướu nguyên phát. Ly trích DNA Từ mẫu mô sinh thiết bằng bộ ly trích QIAmp DNA Mini Kit (QIAGEN). Phản ứng chuỗi polymerase (PCR) Thực hiện PCR khuếch đại exon 1 và exon 2 (Bảng 1 và 2). Bảng 1: Trình tự đoạn mồi gen H-ras Exon Trình tự mồi (5’- 3’) Sản phẩm PCR AGACCCTGTAGGAGGACC (cùng chiều) Exon 1 GAGGAAGCAGGAGACAGG (ngược chiều) 280 bp AGACGTGCCTGTTGGACATC (cùng chiều) Exon 2 GGGCCAGCCTCACGGGGTTC (ngược chiều) 167 bp Bảng 2: PCR khuếch đại vùng exon 1 và 2 Thành phần PCR Thể tích Dung dịch đệm 10X 2,0 μl Các dNTP 0,4 μl Đoạn mồi cùng chiều 0,4 μl Đoạn mồi ngược chiều 0,4 μl Nước cất 15,2 μl Takara Ex Taq polymerase (5 unit/μl) 0,1 μl DNA đã ly trích 1,5 μl Tổng cộng 20,0 μl Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 38 Chương trình PCR 94oC x 2 phút 94oC x 1 phút 56oC (exon 1) hay 62 oC (exon 2) x 1 phút 72oC x 30 giây 35 chu kỳ nhiệt 72oC x 7 phút Mỗi đợt thí nghiệm luôn có một chứng dương đã biết cho kết quả PCR (+) và một chứng âm thay thế DNA bằng nước cất. Kết quả PCR được đánh giá bằng điện di trên gel agarose 2%. Giải trình tự chuỗi DNA Tinh sạch sản phẫm PCR. Tiếp theo, thực hiện PCR để khuếch đại đoạn cần xác định trình tự. Bảng 3: PCR giải trình tự Thành phần PCR Thể tích Dung dịch đệm 5X Đoạn mồi Nước cất Sản phẩm PCR đã tinh sạch BigDye Terminator v3.1 1,0 μl 0,5 μl 3,9 μl 4,0 μl 0,6 μl Tổng cộng 10,0 μl Chương trình PCR 96oC x 2 phút 96oC x 10 giây 53oC x 5 giây 60 oC x 4 phút 25 chu kỳ nhiệt Giữ ở 4oC Kết tủa DNA bằng cách 10 μl sản phẩm DNA từ PCR trên được thêm 30 μl ethanol 100% và 2,5 μl EDTA 125 mM. Quay ly tâm 15000 vòng trong 15 phút. Thêm 30 μl ethanol 70%, quay ly tâm 15000 vòng/phút trong 10 phút. Đổ dịch nổi, lấy cặn lắng và để khô tự nhiên. Hòa tan tủa trong 20 μl dung dịch đệm Formamide. Biến tính DNA ở 95oC trong 2 phút, rồi làm lạnh đột ngột để tách thành các chuỗi đơn DNA. Sau đó đưa vào giếng trong máy giải trình tự DNA tự động ABI-Prism 3100 Genetic Analyzer (Applied Biosystem) để phân tích trình tự nucleotid trên chuỗi DNA. Mỗi đoạn DNA ở các mẫu được giải trình tự hai chiều lần lượt với đoạn mồi cùng chiều và đoạn mồi ngược chiều. Nếu có đột biến thì sẽ phát hiện tại một vị trí có hai nucleotid thay vì chỉ một nucleotid như bình thường, do mẫu DNA được định chuỗi có những chuỗi bình thường và chuỗi đột biến. Kết quả cũng được đối chiếu với trình tự nucleotid trên DNA bình thường trong hệ thống dữ liệu của NCBI (GenBank accession number J00277) để xác định chính xác nucleotid đột biến. Nhuộm hóa mô miễn dịch Mẫu mô vùi nến được cắt thành những lát mỏng 4 μm liên tiếp nhau. Mỗi lát cắt được trải trên phiến kính có tráng silane và sấy khô ở 37oC trên 12 giờ. Các kháng thể đơn dòng DO-7 kháng p53, IF-2 kháng MDM2, và MIB-1 kháng Ki-67 (Dakopatts, Đan Mạch). Qui trình nhuộm theo phương pháp Avidin-Biotin-Peroxidase Complex (ABC), và sử dụng kit Histofine (Nichirei, Nhật Bản). Mỗi đợt nhuộm luôn có một tiêu bản chứng dương chứa mẫu mô đã biết có chứa kháng nguyên cần tìm cho phản ứng dương tính, và một tiêu bản chứng âm thay kháng thể thứ nhất bằng dung dịch đệm PBS. Tế bào bướu được xem là nhuộm dương tính khi nhân tế bào bắt màu nâu. Mức độ nhuộm được tính dựa trên tỉ lệ % số tế bào bướu nhuộm dương tính trên tổng số tế bào bướu đếm trong 3 vi trường x 200 dưới kính hiển vi quang học. Thang đánh giá biểu hiện như sau: P53 hay MDM2 (-): 0-10%, p53 hay MDM2 (+): 11-100% Ki67 (-): 0-20%, Ki67 (+): 21-100%. Phân tích thống kê Tất cả dữ liệu được nhập bằng phần mềm Excel và xử lý bằng phần mềm IBM-SPSS. Phân tích sự liên quan giữa các yếu tố bằng các phép kiểm chi bình phương, chính xác Fisher, McNemar và Mann-Whitney. Liên quan có ý nghĩa khi phép kiểm có P < 0,05. KẾT QUẢ Đột biến gen H-ras Phát hiện đột biến gen H-ras trong 7 ca (38,9%), trên exon 1, với 8 đột biến (Bảng 4): Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 39 -1 ca đột biến thêm 3 nucleotid (GGC) vào giữa codon 10 và codon 11, nên tạo ra thêm 1 axít amin là glycin (10Gly11) trong khung. -1 ca đột biến điểm sai nghĩa tại codon 12 (GGC>AGC) và đột biến im lặng tại codon 27. -1 ca đột biến điểm sai nghĩa tại codon 13 (GGT>CGT). - Và 4 ca đột biến im lặng C81T tại codon 27 biểu hiện đa hình nucleotid đơn (SNP). Không kể đột biến im lặng, tỉ lệ đột biến H- ras là 16,7%, trong đó đột biến điểm chiếm đa số (66,7%). Đột biến H-ras với đột biến p53 Trong mẫu nghiên cứu này, đã phát hiện 8 ca (44,4%) có đột biến gen p53(6). Đối chiếu kết quả cho thấy 4 ca (22,2%) đột biến đồng xảy ra trên cả hai gen p53 và H-ras; tuy nhiên chỉ có đột biến p53 sai nghĩa hay ghép nối sai, trong khi đột biến H-ras im lặng. Bảng 4: Đột biến gen H-RAS và gen p53 Đột biến H-RAS (exon 1và 2) STT Tuổi Giới Thói quen Vị trí Độ mô học Giai đoạn Nucl-eotid Codon Axit Amin Kiểu đ.biến Đột biến p53 (exon5-8) 1 75 Nữ Nhai trầu Má I III 30_31 insGGC 10Gly11 Thêm (-) 2 75 Nữ Nhai trầu Nướu I IV 34 81 GGC-AGC CAT-CAC G12S H27H Sai nghĩa Im lặng (-) 3 80 Nữ Nhai trầu Má I IV 37 GGT-CGT G13R Sai nghĩa (-) 4 53 Nam Hút thuốc Lưỡi II III 81 CAT-CAC H27H Im lặng Sai nghĩa 5 69 Nữ Nhai trầu Má II III 81 CAT-CAC H27H Im lặng Sai nghĩa 6 70 Nam Hút thuốc Sàn m. II III 81 CAT-CAC H27H Im lặng Sai nghĩa Ghép sai 7 51 Nữ Nhai trầu Má I IV 81 CAT-CAC H27H Im lặng Sai nghĩa 8 52 Nữ Nhai trầu Môi I IV (-) Sai nghĩa 9 40 Nữ Không Má II IV (-) Sai nghĩa 10 82 Nam Hút thuốc Lưỡi I III (-) Ghép sai 11 73 Nữ Nhai trầu Má I II (-) Sai nghĩa Đột biến H-ras với lâm sàng-giải phẫu bệnh UTHM Tất cả 3 ca đột biến H-ras xảy ra ở bệnh nhân nữ có thói quen nhai trầu, ung thư ở giai đoạn trễ, bướu có độ ác tính mô học thấp và không có đột biến p53. Phân tích thống kê tìm thấy liên quan có ý nghĩa giữa đột biến H-ras với thói quen nhai trầu (P < 0,05) (Bảng 5). Bảng 5: Đột biến H-ras và lâm sàng-giải phẫu bệnh UTHM Hras Đặc điểm Mẫu 18 ca Không đột biến 15 ca (83,3%) Đột biến 3 ca (16,7%) P ≤ 60 7 7 (100,0) 0 Tuổi > 60 11 8 (72,7) 3 (27,3) 0,245 Nam 7 7 (100,0) 0 Giới tính Nữ 11 8 (72,7) 3 (27,3) 0,245 Hras Đặc điểm Mẫu 18 ca Không đột biến 15 ca (83,3%) Đột biến 3 ca (16,7%) P Nhai trầu 7 4 (57,1) 3 (42,9) Hút thuốc 7 7 (100,0) 0 Thói quen Không 4 4 (100,0) 0 0,043 Lưỡi 7 7 (100,0) 0 Má 6 4 (66,7) 2 (33,3) Nướu răng 1 0 1 (100,0) Vị trí Vị trí khác 4 4 (100,0) 0 0,078 1 + 2 7 5 (71,4) 2 (28,6) Bướu (T) 3 + 4 11 10 (90,9) 1 (9,1) 0,528 N0 6 6 (100,0) 0 Hạch N+ 12 9 (75,0) 3 (25,0) 0,515 1 + 2 3 3 (100,0) 0 Giai đoạn 3 + 4 15 12 (80,0) 3 (20,0) 1,000 Độ mô I 11 8 (72,7) 3 (27,3) 0,245 Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 40 Hras Đặc điểm Mẫu 18 ca Không đột biến 15 ca (83,3%) Đột biến 3 ca (16,7%) P học II 7 7 (100,0) 0 Đột biến gen H-ras và gen p53 với biểu hiện p53, MDM2 và Ki-67 Mặc dù bướu có đột biến p53 hay ras tăng biểu hiện Ki67 cao hơn so với bướu không có đột biến gen này, nhưng sự khác biệt không có ý nghĩa thống kê (P > 0,05) (Bảng 6). Biểu hiện MDM2(+) trong 7 ca (38,9%), nhất là ở người nhai trầu (57,1%), liên quan với đột biến H-ras (P < 0,05) (Bảng 7). Bảng 6: Đột biến H-ras, đột biến p53 với Ki-67 Tổng ca Ki-67 (-) 6 ca (33,3%) Ki-67 (+) 12 ca (66,7%) Trung bình Ki67 ± độ lệch chuẩn P Đột biến p53 – 10 3 (30,0) 7 (70,0) 26,30 ± 17,493 Đột biến p53 + 8 3 (37,5) 5 (62,6) 30,25 ± 16,534 0,687 Đột biến H-ras – 15 6 (40,0) 9 (60,0) 27,87 ± 18,023 Đột biến H-ras + 3 0 3 (100,0) 29,0 ± 9,644 0,437 Bảng 7: Đột biến H-ras với p53, MDM2 Tổng ca Không đột biến H-ras Đột biến H-ras P Đột biến p53 – Đột biến p53 + 10 8 7 (70,0) 8 (100,0) 3 (30,0) 0 0,216 Biểu hiện p53 – Biểu hiện p53 + 3 15 3 (100,0) 12 (80,0) 0 3 (20,0) 0,396 MDM2– MDM2+ 11 7 11 (100,0) 4 (57,1) 0 3 (42,9) 0,043 BÀN LUẬN Đột biến gen đè nén bướu p53 và đột biến oncogen H-ras tương đối phổ biến trong UTHM ở Việt Nam, trong đó đột biến p53 (44,4%) thường gặp hơn đột biến H-ras (16,7%). Mặt khác, đột biến p53 và đột biến H-ras dường như độc lập và loại trừ lẫn nhau: bệnh nhân UTHM hoặc bị đột biến p53 hoặc đột biến H-ras, còn nếu như bị cả hai thì chỉ có đột biến p53 làm biến đổi protein còn đột biến H-ras im lặng. Theo y văn, UTHM ở những nước châu Á phổ biến thói quen nhai trầu thường có đột biến H-ras (như 12,5-35% ở Ấn Độ)(5,9,10), nhưng ít gặp đột biến p53 (Ấn Độ: 17-21%, Đài Loan: 5,4%)(2,3,12). Ngược lại, tỉ lệ đột biến p53 cao ở Nhật Bản (63%), Mỹ (53%), Pháp (67%) - nơi mà hút thuốc và uống rượu được xem là những yếu tố nguy cơ chính(1,2,8), tỉ lệ đột biến H-ras rất thấp (0-5%)(8,10,12). Trong khi đó, ở Việt Nam, tỉ lệ đột biến p53 khá cao gần tương tự ở Nhật Bản và phương Tây, tỉ lệ đột biến H-ras cũng tương đối cao. Đây là điểm khác biệt hiện nay trong bệnh sinh UTHM ở nước ta so với nhiều nước khác. Sự thay đổi nhiều về tỉ lệ đột biến gen trong UTHM giữa các nước chủ yếu do sự khác biệt về thói quen nguy cơ(1,11); ngoài ra có thể do sự khác nhau về kỹ thuật phát hiện, vị trí ung thư(1), chế độ dinh dưỡng, tình trạng răng miệng(11). Mẫu nghiên cứu này có 7 ca (38,9%) nhai trầu (trong đó 5 ca có xỉa thuốc), 7 ca (38,9%) hút thuốc và 4 ca (22,2%) không có những thói quen trên. Đa số đột biến trên gen p53 và H-ras là đột biến điểm. Nhận định này nhất quán với y văn(12). Nghiên cứu chỉ phân tích exon 1 và 2 của gen H-ras, vì đây là những exon dễ bị đột biến nhất, có nhiều điểm nóng đột biến như codon 12 và 13 trên exon 1 (vùng gắn GTP), codon 61 (vùng GTPase) trên exon 2(9,10,11). Đột biến tại những vị trí này khiến cho protein luôn ở trạng thái được hoạt hóa (đột biến tăng chức năng). Kết quả cũng tìm thấy đột biến tại codon 12 và 13. Theo Sathyan và c.s. (2007), đa số đột biến tại codon 12 (63%), kế tiếp codon 13 (32%), codon 61 (5%)(10). Quá trình sinh ung thư ở hốc miệng là một tiến trình đa giai đoạn, ước tính cần khoảng 6-10 lần biến đổi gen(12). Kết quả tỉ lệ cao về đột biến H-ras (42,9%) và biểu hiện quá mức protein MDM2 (57,1%) trong UTHM ở người nhai trầu, cũng như sự liên quan giữa H-ras với thói quen nhai trầu và với protein MDM2 (P < 0,05), cho thấy UTHM ở người nhai trầu thường có đột biến H-ras và biến đổi MDM2. Tại những nước Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 41 có thói quen nhai trầu phổ biến, biểu hiện quá mức MDM2 thường gặp trong UTHM, như tỉ lệ 71% ở Ấn Độ(7). Theo y văn, các nitrosamin trong thuốc lá nhai có thể alkylat hóa DNA ở vị trí nucleotid guanin (G) và thymin (T) dẫn tới chuyển vị G:C > A:T(2,10,11). Trong nghiên cứu này, đột biến chuyển vị (G:C > A:T) phổ biến nhất, gặp trong 1 đột biến sai nghĩa ở người nhai trầu kèm xỉa thuốc và ở tất cả 5 đột biến im lặng ở những bệnh nhân có sử dụng thuốc lá (4 ca nhai trầu- xỉa thuốc và 1 ca hút thuốc). Như vậy, đột biến H-ras có thể liên quan các hóa chất nitrosamin trong thuốc lá nhai hay xỉa. Các ca đột biến H-ras đều tăng biểu hiện protein p53, MDM2 và Ki-67. Điều này có thể giải thích qua vai trò của H-ras, MDM2 và p53 trong tế bào(11,12). Gen H-ras nằm trên nhiễm sắc thể 11 mã hóa protein p21ras định vị ở màng bào tương của màng tế bào, có thể “đóng” hay “mở”. Ras giữ vai trò trung tâm điều hòa tiến trình dẫn truyền các tín hiệu tăng trưởng tế bào. Khi thụ thể tiếp nhận yếu tố tăng trưởng ở màng tế bào kích thích ras ở trạng thái hoạt động và gắn vào GTP, ras có thể gắn và hoạt hóa một chuỗi các protein kiểm soát sự sinh sản, tăng trưởng và biệt hóa như Ras–Raf–MEK–ERK(4,10). Là enzym GTPase, protein p21ras cắt rời phosphat khỏi GTP. Sau khi chuyển GTP thành GDP, p21ras vào trạng thái “đóng” không hoạt động nữa. Tuy nhiên, nếu oncogen ras bị đột biến, sự chuyển đổi này không xảy ra sẽ thúc đẩy tế bào liên tục phân bào (thể hiện Ki67 tăng) gây ra ung thư. Protein p53 được xem là yếu tố bảo vệ bộ gen do ngăn cản tế bào bị tổn thương DNA tiếp tục sinh sản mà phải sửa chữa tổn thương hoặc chết theo lập trình(1,2). Điều hòa hoạt động protein p53 theo 3 cách: do tổn thương DNA, do yếu tố sao chép nhân E2F, và vòng kiểm soát ngược tự điều hòa p53-MDM2(4). Protein MDM2 gắn và phân hủy protein p53, vì vậy sự biến đổi protein MDM2 có thể làm cho protein p53 trở nên bền vững mà không cần đột biến(11). Mặt khác, E2F hoạt hóa p53, cũng như hoạt hóa p19ARF–là yếu tố ngăn cản hoạt động của MDM2 giúp cho p53 không bị MDM2 hủy(4). Chuỗi phản ứng dẫn truyền tín hiệu theo đường Ras–Cyclin D1–pRb–E2F, tiếp theo E2F–19ARF– MDM2–p53 hay E2F–p53(4) cho thấy sự liên hệ giữa ras với MDM2 và p53. Trong mẫu nghiên cứu này, các ca có đột biến H-ras đều xảy ra ở người nhai trầu, giai đoạn trễ, bướu có độ ác tính mô học thấp. Phân tích thống kê ghi nhận đột biến H-ras liên quan có ý nghĩa với biểu hiện MDM2 và với thói quen nhai trầu (P < 0,05). Tuy nhiên, do số ca ít nên những giải thích trên đây cần khẳng định ở cỡ mẫu lớn hơn. KẾT LUẬN Đột biến oncogen H-ras có thể tham gia trong quá trình sinh ung thư hốc miệng ở người Việt Nam. Đột biến H-ras thường gặp trong UTHM ở người nhai trầu, biểu hiện quá mức MDM2, không có đột biến gen đè nén bướu p53. TÀI LIỆU THAM KHẢO 1. Chitra G., Chandramouli A., Chanchal C. (2010). “ P53 mutations in head and neck squamous cell carcinoma”, Int J Pharm Biomed Res 1(3), pp.117-121. 2. Greenblatt M.S., Bennett W.P., Hollstein M., Harris C.C. (1994), “Mutations in the p53 tumor suppressor gene: Clue to cancer etiology and molecular pathogenesis”, Cancer Research 54, pp.4855-4878. 3. Hsieh L.L., Wang P.F., Chen I.H., Liao C.T, Chen C.M., Chang C.J.T. (2001), “Characteristics of mutations in the p53 gene in oral squamous cell carcinoma associated with betael quid chewing and cigarette smoking in Taiwaneses”, Carcinogenesis 22(9), pp.1497-1503. 4. Michalides R.J.A.M. (1999), “Cell cycle regulators: mechanisms and their role in aetiology, pro