Phát hiện đột biến gen UNC13D gây hội chứng thực bào máu ở trẻ em bằng kỹ thuật giải trình tự chuỗi DNA

Giới thiệu: Hội chứng thực bào máu (HCTBM) nguyên phát ở trẻ em thường do đột biến gen gây nên. Trong một nghiên cứu trước đây trên 21 bệnh nhân trẻ em, chúng tôi chỉ phát hiện 1 trường hợp có đột biến gen perforin. Mục tiêu: Nghiên cứu này nhằm khảo sát đột biến gen UNC13D trên 10 bệnh nhân không có đột biến perforin. Đối tượng và phương pháp: Toàn bộ 32 exon và vùng tiếp giáp exon – intron của gen UNC13D đã được khuếch đại và giải trình tự chuỗi DNA. Kết quả: Chúng tôi phát hiện 2 trường hợp có đột biến điểm c.3151G>A ở exon 31 trên genomic DNA. Đột biến tạo nên RNA không toàn vẹn do exon 30 nối trực tiếp với exon 32. Ngoài ra còn có 25 dạng đa hình thái đơn nucleotide được phát hiện. Kết luận: Nghiên cứu trên số mẫu lớn hơn để hiểu rõ phổ đột biến gen UNC13D trên bệnh nhân Việt Nam nên tiếp tục được tiến hành.

pdf7 trang | Chia sẻ: thanhuyen291 | Ngày: 14/06/2022 | Lượt xem: 149 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phát hiện đột biến gen UNC13D gây hội chứng thực bào máu ở trẻ em bằng kỹ thuật giải trình tự chuỗi DNA, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  150 PHÁT HIỆN ĐỘT BIẾN GEN UNC13D   GÂY HỘI CHỨNG THỰC BÀO MÁU Ở TRẺ EM   BẰNG KỸ THUẬT GIẢI TRÌNH TỰ CHUỖI DNA  Hoàng Anh Vũ*, Nguyễn Văn Tân Minh**, Phan Thị Xinh***  TÓM TẮT  Giới  thiệu: Hội chứng thực bào máu (HCTBM) nguyên phát ở trẻ em thường do đột biến gen gây nên.  Trong một nghiên cứu trước đây trên 21 bệnh nhân trẻ em, chúng tôi chỉ phát hiện 1 trường hợp có đột biến gen  perforin.  Mục  tiêu: Nghiên cứu này nhằm khảo sát đột biến gen UNC13D trên 10 bệnh nhân không có đột biến  perforin.  Đối tượng và phương pháp: Toàn bộ 32 exon và vùng tiếp giáp exon – intron của gen UNC13D đã được  khuếch đại và giải trình tự chuỗi DNA.  Kết quả: Chúng tôi phát hiện 2 trường hợp có đột biến điểm c.3151G>A ở exon 31 trên genomic DNA. Đột  biến tạo nên RNA không toàn vẹn do exon 30 nối trực tiếp với exon 32. Ngoài ra còn có 25 dạng đa hình thái  đơn nucleotide được phát hiện.  Kết luận: Nghiên cứu trên số mẫu lớn hơn để hiểu rõ phổ đột biến gen UNC13D trên bệnh nhân Việt Nam  nên tiếp tục được tiến hành.  Từ khóa: hội chứng thực bào máu, đột biến gen UNC13D, giải trình tự chuỗi DNA  ABSTRACT  DETECTION OF UNC13D MUTATIONS IN PEDIATRIC PATIENTS   WITH HEMOPHAGOCYTIC LYMPHOHISTIOCYTOSIS BY DNA SEQUENCING  Hoang Anh Vu, Nguyen Van Tan Minh, Phan Thi Xinh  * Y Hoc TP. Ho Chi Minh * Vol. 17 ‐ Supplement of No 3 ‐ 2013: 150 ‐ 155  Introduction: Hemophagocytic  lymphohistiocytosis,  also  known  as  hemophagocytic  syndrome,  in  early  childhood are commonly caused by gene mutations. In a previous study, we found only one performing mutation  among 21 pediatric patients.  Objective: In the present study, UNC13D mutations were analyzed in 10 wild type‐performing patients.  Patients  and methods: Full  length  of UNC13D  including 32  exons  and  exon‐intron boundaries were  amplified and directly sequenced.  Results: Two out of  ten patients had a point mutation c.3151G>A  in  exon 31. This mutation  led  to an  abnormal  transcript  where  exon  30  joined  up  with  exon  32. Moreover,  we  detected  25  single  nucleotide  polymorphisms along the gen.  Conclusion:  Further  study  with  more  samples  needs  to  be  done  to  know  the  spectrum  of UNC13D  mutations in Vietnamese patients.  Key words: hemophagocytic lymphohistiocytosis, UNC13D gene mutation, DNA sequencing  * Trung tâm Y sinh học phân tử, Đại học Y Dược TPHCM  ** Khoa Xét Nghiệm Huyết học, Bệnh viện Nhi Đồng II TPHCM  *** Bộ môn Huyết học, Đại học Y Dược TP.HCM  Tác giả liên lạc: TS.BS. Hoàng Anh Vũ, ĐT: 0122‐2993537, email: hoangvuxinh@yahoo.com  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  94 ĐẶT VẤN ĐỀ  Hội  chứng  thực  bào  máu  (HCTBM;  hemophagocytic  lymphohistiocytosis  hay  hemophagocytic  syndrome)  ở  trẻ  em  là  một  dạng rối  loạn di truyền được đặc trưng bởi hội  chứng viêm thái quá, với sốt, gan – lách to, giảm  tế bào máu ngoại biên và có thể biểu hiện triệu  chứng  thần  kinh  trung  ương  đi  kèm(4). Dù  có  nhiều nguyên nhân khác nhau, những biểu hiện  lâm sàng ồ ạt của hiện tượng viêm đa hệ thống  và  diễn  tiến  tử  vong  nhanh  chóng  đối  với  HCTBM không được điều trị đã thu hút sự quan  tâm của những chuyên gia về huyết học, miễn  dịch, bệnh truyền nhiễm và di  truyền học. Đến  nay,  HCTBM  vẫn  còn  được  xem  là  một  thử  thách đối với những nhà khoa học trong việc tìm  hiểu sự hình thành cũng như các bất thường của  quá  trình  điều  hòa  phản  ứng  viêm miễn  dịch  trong  cơ  thể  con người. Bệnh diễn  tiến  đến  tử  vong trong vòng vài tuần nếu không được điều  trị bằng thuốc ức chế miễn dịch và thuốc độc tế  bào thích hợp để tạm thời kiểm soát bệnh. Hiện  nay,  ghép  tế  bào  gốc  tạo  máu  được  coi  là  phương  cách duy nhất  có khả năng  chữa khỏi  bệnh(6).  Chẩn  đoán  sớm HCTBM  rất quan  trọng vì  điều trị ưu tiên hàng đầu là ghép tế bào gốc mà  dự hậu của bệnh nhân  tùy  thuộc vào  thời gian  từ  khi mắc  bệnh  đến  được  ghép(8).  Theo  tiêu  chuẩn chẩn đoán HCTBM mới(5), một chẩn đoán  di truyền phân tử phù hợp  là đủ cho một chẩn  đoán xác định bệnh. HCTBM được phân thành  ít  nhất  5  nhóm  theo  bất  thường  của  các  gen  HPLH1,  perforin,  UNC13D,  STX11  và  STXBP2.  Mặc  dù  đột  biến  gen  perforin  chiếm  tỷ  lệ  cao  trong nhóm bệnh nhân thuộc các chủng tộc khác  nhau  như  Nhật  Bản,  Thổ  Nhĩ  Kỳ,  Italia,  Bắc  Mỹ(3), nghiên  cứu  trước  đây  của  chúng  tôi  cho  thấy đột biến gen này đóng vai trò rất nhỏ trong  HCTBM  ở người Việt Nam, với  chỉ 1  trong 21  bệnh nhân  có mang  đột biến(7). Nhằm  tiếp  tục  tìm hiểu cơ chế phân tử của HCTBM trên bệnh  nhân Việt nam, chúng tôi tiến hành khảo sát đột  biến gen UNC13D trên những bệnh nhân không  có đột biến gen perforin.  ĐỐI TƯỢNG ‐ PHƯƠNG PHÁP NGHIÊN CỨU  Đối tượng nghiên cứu  10 bệnh nhi được chẩn đoán hội chứng thực  bào máu theo tiêu chuẩn HLH‐2004 của Henter  và  cộng  sự(5). Các bệnh nhân này  đã  được  xác  định không có đột biến gen perforin trong nghiên  cứu trước đây(7). Phân tích đột biến gen UNC13D  được phối hợp  thực hiện  tại Trung  tâm Y sinh  học phân tử ‐ Đại học Y Dược TPHCM và Khoa  Di truyền học Phân Tử ‐ Bệnh viện Truyền máu  Huyết học TP.HCM  Tách chiết genomic DNA  Chúng tôi dùng QIAamp DNA Kit (Qiagen,  Mỹ) để tách chiết genomic DNA từ 200 μL máu  ngoại vi theo hướng dẫn của nhà sản xuất.  Tách chiết RNA và tổng hợp cDNA  RNA được tách chiết từ 5 mL máu ngoại vi  bằng RNeasy mini Kit (Qiagen, Mỹ) theo hướng  dẫn  của nhà  sản  xuất. RNA  được  đo nồng  độ  bằng  máy  quang  phổ  kế  spectrophotometer.  cDNA được tổng hợp từ 1 μg RNA với bộ hóa  chất  SuperScript™  II  Reverse  Transcriptase  (Invitrogen, Mỹ).  Thiết kế mồi cho PCR (polymerase chain reaction)  Các đoạn mồi được thiết kế bằng phần mềm Oligo 4.1 dựa trên trình tự chuẩn của UNC13D mang  accession number NG_007266 trong GenBank. Thông tin về các đoạn mồi được trình bày trong Bảng  1.  Bảng 1: Thông tin về các đoạn mồi dùng trong PCR.  Tên Trình tự (5’---3’) Vùng gen được khuếch đại Sản phẩm PCR (bp) UNC-g1F ATAATCCTGTGGCTTCGCTG Exon 1 – 6 (genomic DNA) 2059 UNC-g6R AGGACGACCTACTCATCTCA UNC-g7F TGTGGTCACTTACTGCTTCG Exon 7 – 12 (genomic DNA) 1343 Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  152 UNC-g12R CAAAGGGAACTCTGCTGAGA UNC-g13F TCAGCCTGTACTGGTGGATG Exon 13 – 20 (genomic DNA) 1700 UNC-g20R ACTACGCTTTGGAGGTCCAG UNC-g21F TCTGTGCCTGGTGATGGTAG Exon 21 – 25 (genomic DNA) 2288 UNC-g25R TACACCCCTCAGAACGGATG UNC-g26F CGTCTTTGCTTCCTCCTCCG Exon 26 – 32 (genomic DNA) 3526 UNC-R6 GGGAAGCCCCAGACCCTACA UNC-F1 CTTCGCTGTCTTCACCCAG Exon 1 – 12 (RNA) 1061 UNC-R2 AAAGAGGACGGTGGCAGCCT UNC-F3 ACGAGGTCACCCAGCACGAG Exon 12 – 21 (RNA) 1158 UNC-R4 TGTTGGCTGCCTGGCCTTGG UNC-F4 CTTGCTGGGCCTGGTACAGG Exon 17 – 32 (RNA) 1879 UNC-R6 GGGAAGCCCCAGACCCTACA Thực hiện PCR  Trong mỗi tube PCR có tổng thể tích 25 μL,  các  thành phần gồm có PCR buffer, dNTP  (250  μM cho mỗi loại), 2 loại mồi xuôi và ngược (0,5  μM  cho  mỗi  loại),  TaKaRa  TaqTM  HotStart  Polymerase  (1,25 unit) và 20 ng genomic DNA  hoặc cDNA. Chu kỳ  luân nhiệt được  thực hiện  trên máy GeneAmp® PCR system 9700 (Applied  Biosystems, Mỹ)  bao  gồm  giai  đoạn  biến  tính  ban đầu ở 980C  trong 2 phút,  theo sau bằng 40  chu kỳ gồm biến tính ở 980C trong 10 giây, gắn  mồi ở 600C trong 20 giây, tổng hợp chuỗi DNA ở  720C trong 2 phút và kết thúc bằng giai đoạn kéo  dài  sản phẩm  ở 720C  trong 5 phút. Riêng PCR  của cặp mồi UNC‐g26F và UNC‐R6  (exon 26 –  32) được  thực hiện gắn mồi và  tổng hợp chuỗi  DNA ở 680C trong 3 phút. Sản phẩm PCR được  phát hiện bằng điện di trên  thạch agarose 1,2%  có nhuộm ethidium bromide và quan  sát dưới  màn  soi  gel  Pringraph  (Atto,  Nhật  Bản),  tinh  sạch bằng QIAquick Gel Extraction kit và được  kiểm  tra  lại  bằng  điện  di  trên  thạch  agarose  1,2%.  Thực hiện giải trình tự chuỗi DNA  Sản phẩm PCR  đã  được  tinh  sạch  sẽ  được  thực  hiện  phản  ứng  cycle  sequencing  với  BigDye  V3.1  từ  Applied  Biosystems,  theo  2  chiều  xuôi  và ngược  cho mỗi  exon.  Sản phẩm  sau đó được kết tủa bằng ethanol, hòa tan trong  Hi‐Di formamide, biến tính ở 950C trong 2 phút  trước khi làm lạnh đột ngột. Trình tự DNA được  đọc bằng máy ABI  3130 Genetic Analyzer, với  POP‐7  polymer  và  capillary  80  cm  (Applied  Biosystems, Mỹ). Kết quả được phân  tích bằng  phần  mềm  SeqScape.  Số  thứ  tự  của  các  nucleotide  được  tính  theo  chuỗi  cDNA  bình  thường  của  UNC13D mang  accession  number  NG_007266 trong GenBank. Thuật ngữ dùng để  mô tả các  thay đổi  trình  tự DNA dựa  theo den  Dunen và  cộng  sự(1). Adenine  đầu  tiên  của mã  khởi  đầu ATG mang  số  +1,  “c.”  để  chỉ  cDNA,  “IVS” chỉ intron: G của GT đầu tiên trong intron  mang  số  +1, G  của AG  cuối  cùng  trong  intron  mang số ‐1.  KẾT QUẢ  Xây dựng kỹ  thuật giải  trình  tự DNA của  gen UNC13D  Gen UNC13D  gồm  32  exon  với  tổng  chiều  dài khoảng  17,5 kb.  Để khuếch  đại  toàn bộ  32  exon  và  vùng  tiếp  giáp  exon  –  intron  của  genomic DNA, chúng tôi thiết kế 5 cặp mồi, với  các sản phẩm PCR trong khoảng 1343 – 3526 bp.  Hình 1A  cho  thấy mỗi  cặp mồi  đã khuếch  đại  đặc  hiệu  các  vùng  exon  –  intron  của  gen  UNC13D.  Phản  ứng  reverse  transcriptase  PCR  cũng  được  thực  hiện  để  kiểm  tra  đột  biến  ở  mức  RNA. Trong hình 1B, các đoạn cDNA đã được  khuếch đại với kích thước tương ứng 1061, 1158  và 1879 bp.  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013  Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh  153 Các  sản phẩm PCR  sau khi  được  tinh  sạch  đã được  tiến hành giải  trình  tự chuỗi DNA  để  xác định các thay đổi trên gen UNC13D. Toàn bộ  các kết quả giải trình tự chuỗi DNA đều cho kết  quả đặc hiệu với các vùng gen UNC13D đã được  khuếch đại.  Phát hiện đột biến gen UNC13D trên bệnh  nhân hội chứng thực bào máu  Do hạn chế của kinh phí và thời gian, chúng  tôi chỉ tiến hành khảo sát đột biến gen UNC13D  trên 10 bệnh nhân đã được loại trừ đột biến gen  perforin. Có tất cả 26 kiểu thay đổi trên exon và  intron được phát hiện (Bảng 2). Hầu hết các thay  đổi này  là những  SNP  đã  được  báo  cáo  trước  đây(13),  ngoại  trừ  thay  đổi  IVS26+5C>G  thuộc  intron 26 và thay đổi c.3151G>A thuộc exon 31.  Chúng tôi không thể  thực hiện khảo sát ở mức  RNA cho bệnh nhân có  IVS26+5C>G do không  có mẫu dự  trữ  thích  hợp  cho  nghiên  cứu  tiếp  theo.  Bảng 2: Các thay đổi của gen UNC13D được phát  hiện trong nghiên cứu này.  Thay đổi nucleotide Vị trí Thay đổi amino acid Số trường hợp (n = 10) IVS1+30G>A Intron 1 3 IVS1+59C>T Intron 1 3 IVS2+67C>T Intron 2 3 IVS2-19G>A Intron 2 2 IVS2-16G>A Intron 2 1 IVS3+26C>G Intron 3 2 IVS3+69G>A Intron 3 1 c.279C>T Exon 4 Pro93Pro 2 IVS5+81G>A Intron 5 1 IVS5+122C>T Intron 5 1 c.888G>C Exon 11 Pro296Pro 1 IVS12-13C>T Intron 12 3 IVS18+36A>G Intron 18 3 IVS19+70T>C Intron 19 3 c.1744C>T Exon 20 Leu582Leu 1 c.1977C>T Exon 21 Thr659Thr 2 IVS21+5G>A Intron 21 1 IVS23-46C>T Intron 23 3 IVS25-8delC Intron 25 3 IVS26+5C>G Intron 26 1 c.2599A>G Exon 27 Lys867Glu 1 IVS28+48C>T Intron 28 2 IVS29+37C>G Intron 29 1 c.3151G>A Exon 31 Chưa rõ 2 IVS31+82G>A Intron 31 1 c.3198A>G Exon 32 Glu1066Glu 3 Trong 2 bệnh nhân  có  thay  đổi  c.3151G>A,  chúng tôi đã tiến hành khảo sát được bất thường  ở mức  RNA  cho một  bệnh  nhân. Hình  2  cho  thấy  có  sự  cắt bỏ  exon 31  trong bản phiên mã  RNA của bệnh nhân này. Hậu quả là protein bị  đột biến  có  13  amino  acid mới  được  tạo  trước  khi có hiện tượng cắt bỏ phần đuôi carboxyl.  BÀN LUẬN  Đột biến gen UNC13D lần đầu tiên được mô  tả  vào  năm  2003  trên  những  bệnh  nhân  bị  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  154 HCTBM(2). Các nghiên cứu  tại nhiều nước, bao  gồm Hàn Quốc(12) và Nhật Bản(11)  cho  thấy  đột  biến UNC13D  đóng vai  trò nguyên nhân quan  trọng trong HCTBM. Nghiên cứu của chúng tôi  lần  đầu  tiên mô  tả  đột biến gen UNC13D  trên  bệnh nhân  trẻ em Việt Nam. Các  thay  đổi  của  gen UNC13D  được  chúng  tôi phát hiện  rất  đa  dạng  và  phức  tạp,  xảy  ra  dọc  chiều  dài  gen,  thuộc cả vùng exon và intron. Vì đột biến không  tập trung vào vùng nào nhất định nên việc xác  định được đột biến đòi hỏi phải khảo sát toàn bộ  chiều dài gen, bao gồm 32 exon và vùng exon –  intron, bằng kỹ  thuật giải  trình  tự chuỗi DNA.  Theo  các  tác giả Nhật Bản,  cần  28  cặp mồi  để  khuếch  đại  gen UNC13D(11). Nhờ  việc  thiết  kế  các cặp mồi  thích hợp có  thể  tạo  ra những sản  phẩm PCR dài  trên 3 kb,  chúng  tôi  đã khuếch  đại toàn bộ 32 exon của gen UNC13D chỉ bằng 5  cặp mồi đặc hiệu.  Trong 10 bệnh nhân, chúng  tôi phát hiện 2  trường hợp  có  đột biến  c.3151G>A  thuộc  exon  31. Đây là đột biến mới, chưa từng được báo cáo  trong các nghiên cứu trước đây. Đột biến này đã  được khẳng  định  lại  ở mức RNA, với  sự  trượt  mất  exon  31,  gây  phá  vỡ  khung  đọc  giải mã.  Protein bị đột biến không có đầy đủ chức năng  trong  tế bào do  thiếu  đuôi  carboxyl. Như vậy,  bản  chất  của  đột biến này  là  sự khiếm khuyết  trong quá trình tạo RNA trong tế bào miễn dịch,  với sự ghép nối exon không hoàn hảo. Phát hiện  của  chúng  tôi phù hợp với  các kết quả nghiên  cứu  trước  đây  của  các  tác  giả  nước  ngoài  khi  thấy  rằng phần  lớn  các  đột biến gen UNC13D  ảnh hưởng trên quá trình hình thành RNA(9,10,12).  Trong số những thay đổi khác của UNC13D mà  chúng  tôi  phát  hiện  trong  nghiên  cứu  này,  IVS1+59C>T được một số tác giả coi là đột biến  vì  tạo nên vị  trí  tiếp nhận  exon mới(10), nhưng  cũng có nghiên cứu khác chứng minh đây chỉ là  SNP  không  có  ý  nghĩa  gây  bệnh,  với  mã  số  rs3744010.  Trên  3  bệnh  nhân  có  IVS1+59C>T,  chúng  tôi đã khảo sát mức RNA nhưng không  phát  hiện  được  bất  thường  nào.  Kết  quả  của  chúng  tôi ủng hộ nhận định  IVS1+59C>T chỉ  là  một dạng SNP trong HCTBM.  Thay  đổi  IVS26+5C>G  chỉ  được  phát  hiện  trên  1  bệnh  nhân.  Chúng  tôi  không  thấy  có  nghiên  cứu  nào  trước  đây  từng  mô  tả  bất  thường này. Tuy nhiên, vì không có mẫu RNA  để khảo sát  thêm nên chưa  thể khẳng định bất  thường ở vùng intron 26 này có ảnh hưởng lên  sự ghép nối exon hay không. Để  có  thể khẳng  định đây là đột biến mới hay chỉ là một SNP cần  khảo sát thêm trên những mẫu chứng của người  khỏe mạnh  để  có  tần  suất phân bố alen  tương  ứng tại vị trí ‐5 của intron này.  KẾT LUẬN  Chúng tôi đã ứng dụng thành công kỹ thuật  giải  trình  tự  chuỗi DNA  để  phát  hiện  2  bệnh  nhân có đột biến gen UNC13D trong số 10 bệnh  nhân được khảo sát. Cần có nghiên cứu với số  mẫu lớn hơn để biết được phổ đột biến gen này  trên bệnh nhân HCTBM tại Việt Nam, góp phần  hữu  ích  cho  công  tác  chẩn  đoán  chính  xác  và  quyết định điều trị hợp lý hơn cho bệnh nhân.  TÀI LIỆU THAM KHẢO  1.  den  Dunnen  JT,  Antonarakis  SE  (2000).  Mutation  nomenclature extensions and suggestions to describe complex  mutations: a discussion. Hum Mutat;15(1):7‐12.  2. Feldmann J, Callebaut I, Raposo G, Certain S, Bacq D, Dumont  C,  et  al  (2003). Munc13‐4  is  essential  for  cytolytic  granules  fusion and  is mutated  in a  form of  familial hemophagocytic  lymphohistiocytosis (FHL3). Cell;115(4):461‐73.  3. Gholam  C,  Grigoriadou  S,  Gilmour  KC,  Gaspar HB  (2011)  Familial  haemophagocytic  lymphohistiocytosis:  advances  in  the  genetic  basis,  diagnosis  and  management.  Clin  Exp  Immunol;163(3):271‐83.  4. Henter  JI, Arico M, Elinder G,  Imashuku S,  Janka G.  (1998).  Familial  hemophagocytic  lymphohistiocytosis.  Primary  hemophagocytic  lymphohistiocytosis.  Hematol  Oncol  Clin  North Am;12(2):417‐33.  5. Henter  JI,  Horne  A,  Arico  M,  Egeler  RM,  Filipovich  AH,  Imashuku  S,  et  al  (2007).  HLH‐2004:  Diagnostic  and  therapeutic  guidelines  for  hemophagocytic  lymphohistiocytosis. Pediatr Blood Cancer;48(2):124‐31.  6. Henter JI, Samuelsson‐Horne A, Arico M, Egeler RM, Elinder  G, Filipovich AH, et al  (2007). Treatment of hemophagocytic  lymphohistiocytosis with HLH‐94 immunochemotherapy and  bone marrow transplantation. Blood;100(7):2367‐73.  7. Hoàng  Anh  Vũ,  Nguyễn  Văn  Tân  Minh,  Phan  Thị  Xinh.  (2012). Phát hiện đột biến gen perforin gây hội chứng thực bào  máu ở  trẻ em bằng kỹ  thuật giải  trình  tự chuỗi DNA. Y học  Việt Nam;396:152‐157.  8. Horne A, Janka G, Maarten Egeler R, Gadner H, Imashuku S,  Ladisch  S,  et  al  (2005).  Haematopoietic  stem  cell  transplantation  in haemophagocytic  lymphohistiocytosis. Br  J  Haematol;129(5):622‐30.  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013  Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh  155 9. Meeths M, Chiang SC, Wood SM, Entesarian M, Schlums H,  Bang  B,  et  al  (2011).  Familial  hemophagocytic  lymphohistiocytosis  type  3  (FHL3)  caused  by  deep  intronic  mutation and inversion in UNC13D. Blood;118(22):5783‐93.  10. Santoro  A,  Cannella  S,  Trizzino  A,  Bruno  G,  De  Fusco  C,  Notarangelo  LD,  et  al  (2008).  Mutations  affecting  mRNA  splicing  are  the most  common molecular  defect  in  patients  with  familial  hemophagocytic  lymphohistiocytosis  type  3.  Haematologica;93(7):1086‐90.  11. Yamamoto K, Ishii E, Sako M, Ohga S, Furuno K, Suzuki N, et  al  (2004).  Identification  of  novel  MUNC13‐4  mutations  in  familial haemophagocytic  lymphohistiocytosis and  functional  analysis  of MUNC13‐4‐deficient  cytotoxic  T  lymphocytes.  J  Med Genet;41(10):763‐7.  12. Yoon HS, Kim HJ, Yoo KH, Sung KW, Koo HH, Kang HJ, et al  (2010).  UNC13D  is  the  predominant  causative  gene  with  recurrent splicing mutations  in Korean patients with  familial  hemophagocytic  lymphohistiocytosis.  Haematologica;95(4):622‐6.  13. Zhang  K,  Biroschak  J,  Glass  DN,  Thompson  SD,  Finkel  T,  Passo MH,  et  al  (2008). Macrophage  activation  syndrome  in  patients with systemic juvenile idiopathic arthritis is associated  with MUNC13‐4 polymorphisms. Arthritis Rheum;58(9):2892‐ 6.  Ngày nhận bài báo      16‐06‐2013  Ngày phản biện nhận xét bài báo:  20‐06‐2013  Ngày bài báo được đăng:    15–07‐2013