Đặc điểm đột biến gen KIT trong u mô đệm đường tiêu hóa

Mục tiêu: U mô đệm đường tiêu hóa (UMĐĐTH) là u trung mô thường gặp nhất của đường tiêu hóa, thường có CD117 (+). Đột biến gen KIT gặp trong khoảng 60 – 80% trường hợp UMĐĐTH, là đích điều trị của imatinib. Chúng tôi thực hiện nghiên cứu này nhằm khảo sát đặc điểm đột biến gen KIT trong UMĐĐTH. Đối tượng và phương pháp nghiên cứu: 93 trường hợp UMĐĐTH chẩn đoán tại Bộ môn Giải Phẫu Bệnh ‐ Đại học Y Dược Tp. Hồ Chí Minh từ 01/2007 đến 12/2012 được khảo sát đột biến gen KIT ở các exon 9, 11, 13 và 17 bằng kỹ thuật giải trình tự gen. Kết quả: 57 trường hợp có đột biến KIT (61,3%). Đột biến gặp ở mọi vị trí UMĐĐTH được khảo sát bao gồm dạ dày, ruột non, đại trực tràng, mạc treo và sau phúc mạc. Đột biến nhạy với imatinib ở exon 11 thường gặp nhất (54,8%) và rất đa dạng, bao gồm đột biến điểm, đột biến mất đoạn, chèn đoạn và đột biến phức tạp. Các đột biến ít nhạy với imatinib được phát hiện ở exon 9 (2 trường hợp) và exon 17 (4 trường hợp). Đột biến exon 9 xảy ra ưu thế ở ruột non và có tiên lượng xấu. Kết luận: Đa số UMĐĐTH có đột biến gen KIT, ưu thế exon 11 với các đột biến mất đoạn và đột biến điểm thường gặp. Đột biến gen KIT exon 9 ưu thế ở ruột non và bệnh cảnh lâm sàng tiến triển.

pdf7 trang | Chia sẻ: thuyduongbt11 | Ngày: 11/06/2022 | Lượt xem: 262 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Đặc điểm đột biến gen KIT trong u mô đệm đường tiêu hóa, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013  Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh  43 ĐẶC ĐIỂM ĐỘT BIẾN GEN KIT TRONG U MÔ ĐỆM ĐƯỜNG TIÊU HÓA   Ngô Quốc Đạt*, Trần Hương Giang*, Hoàng Anh Vũ**, Hứa Thị Ngọc Hà*  TÓM TẮT  Mục tiêu: U mô đệm đường tiêu hóa (UMĐĐTH) là u trung mô thường gặp nhất của đường tiêu hóa, thường  có CD117 (+). Đột biến gen KIT gặp trong khoảng 60 – 80% trường hợp UMĐĐTH, là đích điều trị của imatinib.  Chúng tôi thực hiện nghiên cứu này nhằm khảo sát đặc điểm đột biến gen KIT trong UMĐĐTH.  Đối tượng và phương pháp nghiên cứu: 93 trường hợp UMĐĐTH chẩn đoán tại Bộ môn Giải Phẫu Bệnh ‐  Đại học Y Dược Tp. Hồ Chí Minh từ 01/2007 đến 12/2012 được khảo sát đột biến gen KIT ở các exon 9, 11, 13 và  17 bằng kỹ thuật giải trình tự gen.  Kết quả: 57 trường hợp có đột biến KIT (61,3%). Đột biến gặp ở mọi vị trí UMĐĐTH được khảo sát bao gồm  dạ dày, ruột non, đại trực tràng, mạc treo và sau phúc mạc. Đột biến nhạy với imatinib ở exon 11 thường gặp nhất  (54,8%) và rất đa dạng, bao gồm đột biến điểm, đột biến mất đoạn, chèn đoạn và đột biến phức tạp. Các đột biến ít  nhạy với imatinib được phát hiện ở exon 9 (2 trường hợp) và exon 17 (4 trường hợp). Đột biến exon 9 xảy ra ưu thế  ở ruột non và có tiên lượng xấu.  Kết luận: Đa số UMĐĐTH có đột biến gen KIT, ưu thế exon 11 với các đột biến mất đoạn và đột biến điểm  thường gặp. Đột biến gen KIT exon 9 ưu thế ở ruột non và bệnh cảnh lâm sàng tiến triển.  Từ khóa: u mô đệm đường tiêu hóa, giải trình tự gen, đột biến, đột biến điểm  ABSTRACT  DETECTION OF KIT MUTATIONS IN GASTROINTESTINAL STROMAL TUMORS   Ngo Quoc Dat, Tran Huong Giang, Hoang Anh Vu, Hua Thi Ngoc Ha  * Y Hoc TP. Ho Chi Minh * Vol. 17 ‐ Supplement of No 3 ‐ 2013: 43 ‐ 50  Objectives:  Gastrointestinal  stromal  tumor  (GISTs)  is  the  most  common  mesenchymal  tumor  of  the  gastrointestinal tract, often showing CD117 expression. About 60–80% of GISTs have mutations of the KIT gene,  which are therapeutic targets for imatinib. Our aim is to analyse KIT mutations in GISTs.  Materials and methods: Tumors from 93 patients with GISTs diagnosed at Department of Pathology from  January 2007 to December 2012 were analysed for mutations in KIT exons 9, 11, 13, and 17.  Results: In total, 57 mutations (61.3%) were detected in all sites of GISTs including stomach, small intestine,  colon, mesentery, and retroperitoneum.  Imatinib‐sensitive mutations  in exon 11 are  the most common mutations  detected (54.8%) which include point mutation, deletion, insertion, and complex mutation. In addition, 2 mutations  were  found  in exon 9 and 4 in exon 17. KIT exon 9 mutations are  located predominantly  in the small bowel and  associated with an unfavorable clinical course.  Conclusion: The majority of GISTs show KIT mutations, located with predilection in exon 11 in which deletion  and point mutation are predominant. KIT exon 9 mutations located predominantly in the small bowel and associated  with an unfavorable clinical course.  Key words: gastrointestinal stromal tumor, sequencing, mutation, point mutation  * Bộ môn Giải Phẫu Bệnh, Đại học Y Dược TPHCM  ** Trung tâm Y sinh học Phân tử, Đại học Y Dược TPHCM  Tác giả liên lạc: TS. BS. Ngô Quốc Đạt  ĐT: 0903619468  Email: quocdat_yds@yahoo.com  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  44 ĐẶT VẤN ĐỀ  U mô  đệm  đường  tiêu  hóa  (UMĐĐTH)  là  loại u  trung mô đường  tiêu hóa đặc hiệu, biểu  hiện  dương  tính  với  protein  KIT  (CD117)  và/hoặc có đột biến tăng chức năng của tiền gen  sinh ung KIT hoặc PDGFRA. Đặc điểm mô bệnh  học của UMĐĐTH rất đa dạng với ưu thế loại tế  bào hình  thoi hoặc dạng biểu mô(7,14). Trên 95%  UMĐĐTH dương  tính với KIT  (CD 117), ngay  cả ở nhóm u với kiểu gen KIT không đột biến. 2‐ 5%  UMĐĐTH  không  có  đột  biến  gen  KIT,  nhưng phần  lớn các  trường hợp này biểu hiện  đột  biến  với  gen  PDGFRA  cũng  là  thụ  thể  tyrosin kinase (TK). Hiện nay, kỹ thuật giải trình  tự chuỗi DNA góp phần rất lớn trong việc chẩn  đoán các đột biến gen vì kỹ thuật này cho phép  phát hiện được vị trí các kiểu đột biến của đoạn  gen muốn khảo sát. Khám phá đột biến gen KIT  và PDGFRA  trong UMĐĐTH  có ý nghĩa quan  trọng trong điều trị và tiên lượng bệnh. Imatinib  mesylate là thuốc ức chế chuyên biệt trên thụ thể  TK thuộc ABL, KIT và PDGFRA hiện nay được  chỉ  định  điều  trị những  bệnh nhân UMĐĐTH  giai  đoạn  trễ  khi  không  thể  phẫu  thuật  lấy  u  hoặc u đã cho di căn(12). Tuy nhiên, mức độ nhạy  với imatinib không giống nhau giữa các kiểu đột  biến. Đột biến gen KIT thường gặp nhất ở exon  11 và nhạy với imatinib (80%); các đột biến exon  9, 13 và 17 hiếm gặp hơn, ít nhạy (đột biến exon  9  đáp  ứng  imatinib  50%)  hoặc  kháng  với  imatinib  (đột  biến  exon  17)(5).  Vì  thế,  việc  xác  định đột biến của gen KIT rất có ý nghĩa  trong  điều trị imatinib cho bệnh nhân. Nghiên cứu này  nhằm mô  tả đặc điểm đột biến gen KIT của 93  bệnh nhân UMĐĐTH tại bộ môn giải phẫu bệnh  Đại Học Y Dược TPHCM.  Mục tiêu  Khảo  sát  đặc  điểm  đột  biến  gen  KIT  trên  exon số 9, 11, 13 và 17.  ĐỐI TƯỢNG ‐ PHƯƠNG PHÁP NGHIÊN CỨU  Đối tượng nghiên cứu  Bệnh  nhân  được  chẩn  đoán  xác  định  là  UMĐĐTH (CD117 dương tính) tại Bộ môn Giải  Phẫu Bệnh Đại học Y Dược Tp. Hồ Chí Minh từ  01/2007 đến 12/2012.  Tiêu chuẩn chọn bệnh  Các trường hợp UMĐĐTH được chẩn đoán  xác định bằng HMMD với CD117 dương tính.  Có đầy đủ  thông  tin về vị  trí u, chẩn đoán  lâm sàng và đặc điểm đại thể u.  Có đầy đủ khối mô vùi nến.  Tiêu chuẩn loại trừ  Các u  trung mô  đường  tiêu hóa  có CD117  âm tính.  Các  trường hợp UMĐĐTH không có  thông  tin về vị trí u, chẩn đoán lâm sàng, đặc điểm đại  thể u.  Không đầy đủ khối mô u vùi nến.  Phương pháp nghiên cứu  Nghiên cứu mô tả cắt ngang.  Các bước tiến hành  Khảo  sát một  số  đặc  điểm  lâm  sàng  ‐  giải  phẫu  bệnh  của  93  trường  hợp  UMĐĐTH  từ  phiếu xét nghiệm Giải phẫu bệnh.  Phân  tích đột biến gen KIT  tại 4 exon 9, 11,  13  và  17  bằng  phương  pháp  giải  trình  tự  gen  trực  tiếp  trên khối mô u vùi nến qua các bước  căn bản sau:  Cắt  mỏng  mô  u  đã  vùi  nến  10μm,  khử  paraffin bằng xylen và cồn tuyệt đối.  Ly trích DNA từ mẫu mô u.  Chạy PCR cho 4 exon số 9, số 11, số 13 và số  17.  Tinh sạch sản phẩm PCR.  Chạy phản  ứng  chuỗi  sequence mẫu DNA  đã tinh sạch cho 4 exon số 9, số 11, số 13 và số  17.  Phân tích đột biến.  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013  Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh  45 Bảng 1: Các đoạn mồi dùng trong nghiên cứu đột biến gen KIT.  Tên mồi Trình tự DNA (5’---3’) Exon được khuếch đại Sản phẩm PCR (bp) KIT-9F AGTATGCCACATCCCAAGTG 9 317 KIT-9R CAGAGCCTAAACATCCCCTTA KIT-11F CCAGAGTGCTCTAATGACTG 11 236 KIT-11R ACCCAAAAAGGTGACATGGA KIT-13F CATCAGTTTGCCAGTTGTGC 13 182 KIT-13R CAGCTTGGACACGGCTTTAC KIT-17F GAACATCATTCAAGGCGTAC 17 392 KIT-17R TTTACATTATGAAAGTCACAGG KẾT QUẢ VÀ BÀN LUẬN  Đặc  điểm  lâm  sàng  –  giải  phẫu  bệnh  UMĐĐTH  Bệnh nhân UMĐĐTH có độ  tuổi dao  động  từ  17  đến  88  tuổi.  Tuổi  trung  bình  là  55  tuổi.  Bệnh phân bố đều ở cả 2 giới. Nghiên cứu này  ghi nhận 49 trường hợp UMĐĐTH ở dạ dày, 28  trường hợp ở ruột non, 6 trường hợp ở đại trực  tràng, 10 trường hợp ngoài đường tiêu hóa. Kích  thước khối u dao động từ 1cm dến 23 cm, kích  thước trung bình 8cm. 49 trường hợp UMĐĐTH  có  độ ác cao,  chiếm 52,7%. 36,5% bệnh nhân  ở  giai  đoạn  tiến  xa  (u  di  căn  gan  và  phúc mạc)  (Bảng 2).  Bảng 2: Đặc điểm lâm sàng – giải phẫu bệnh  UMĐĐTH.  Số trường hợp (n = 93) Số bệnh nhân Tỷ lệ % Tuổi trung bình 55 tuổi Giới tính Nam 47 49,5% Nữ 46 50,5% Vị trí Dạ dày 49 52,7% Ruột non 28 30,1% Đại trực tràng 6 6,5% Mạc treo 7 7,5% Sau phúc mạc 3 3,2% Kích thước u < 5 cm 37 39,8% 5-10 cm 25 26,9% > 10 cm 31 33,3% Loại tế bào Hình thoi 70 75,3% Dạng biểu mô 12 12,9% Hỗn hợp 11 11,8% Chỉ số phân bào < 5 PB/50 QTL 41 44,1% 5-10 PB/50 QTL 21 22,6% > 10 PB/50 QTL 31 33,3% Tiềm năng ác tính (Fletcher) Thấp và rất thấp 27 29,1% Trung bình 17 18,3% Cao 49 52,7% Giai đoạn u Khu trú 59 63,5% Lan rộng (u di căn gan và phúc mạc) 34 36,5% Các  nghiên  cứu  khác  cũng  ghi  nhận  tuổi  trung  bình  của  bệnh  nhân UMĐĐTH  khoảng  50‐60  tuổi(13,15) và không  có  sự khác biệt về  tần  xuất mắc bệnh giữa nam và nữ, ngoại  trừ  các  trường  hợp  UMĐĐTH  ác  tính  thì  tỉ  lệ  nam  nhiều hơn nữ(8,15).  UMĐĐTH  ở  dạ  dày  là  vị  trí  thường  gặp  nhất,  tiếp  theo  là  ruột non,  tỷ  lệ này cũng phù  hợp với  các nghiên  cứu khác(13,18). UMĐĐTH  ở  dạ dày có tiên lượng tốt hơn, ít tái phát và di căn  hơn so với vị trí ruột non. U mô đệm đường tiêu  hóa ở ruột non có khả năng  tái phát cao gấp 4  lần u ở dạ dày (40% so với 9%). Khoảng 20‐25%  UMĐĐTH ở dạ dày biểu hiện ác tính, ngược lại  có đến 40‐50% UMĐĐTH ở ruột non biểu hiện  ác tính(15). Hình thái tế bào  trong UMĐĐTH ưu  thế  loại  tế  bào  hình  thoi,  tương  tự  các  nghiên  cứu khác(13,18).  Hiện nay,  tiên  lượng UMĐĐTH rất khó dự  đoán. Nhìn  chung,  tỉ  lệ  tái  phát  sau  cắt  bỏ  u  khoảng 40%‐70%, trung bình 54% trong vòng 5  năm(20). Một số  trường hợp đặc biệt, UMĐĐTH  cho di căn hoặc tái phát, sau đó bệnh nhân được  điều trị cắt bỏ khối u, tiên lượng của bệnh nhân  vẫn rất tốt, thậm chí có trường hợp u còn thoái  triển tự nhiên. Nghiên cứu của chúng tôi có một  trường  hợp  UMĐĐTH  ở  hỗng  tràng  có  tiềm  năng ác tính cao, tái phát đến 9  lần và xâm  lấn  hết các cơ quan ở chu cung, không có di căn gan,  phổi, xương, được điều trị imatinib với liều gấp  đôi, bệnh nhân tử vong sau 106 tháng vì nhiễm  trùng  tiểu  (Bệnh nhân: Trương Bích L, 60  tuổi,  Mã số giải phẫu bệnh: Y11‐16197). Nhìn chung,  những  trường hợp UMĐĐTH  tái phát hoặc di  căn  được  xếp  vào  nhóm  có  tiên  lượng  xấu.  Ngoài việc  cắt bỏ khối u di  căn hoặc  tái phát,  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  46 bệnh nhân cần phải được khảo sát đột biến gen  KIT và gen PDGFRA, đồng thời điều trị thêm với  thuốc ức chế  thụ  thể TK  là  imatinib. Nếu bệnh  nhân đã được điều trị imatinib rồi mà vẫn diễn  tiến di căn hoặc  tái phát  thì phải xem xét  tăng  liều  điều  trị  với  imatinib  hoặc  điều  trị  bằng  sunitinib (thuốc ức chế  thụ  thể TK  thế hệ mới)(  9,10, 12).  Nghiên cứu này khá phù hợp với các nghiên  cứu khác khi ghi nhận gan và phúc mạc là hai vị  trí di  căn  thường gặp nhất. U hiếm khi  cho di  căn  đến  xương,  phổi  và  não  (mặc  dù  đều  là  những vị trí di căn theo đường máu)(18,19). Lopes  LF và cs còn báo cáo một số vị trí di căn rất hiếm  gặp  khác  như  tuyến  thượng  thận  và  buồng  trứng(18).  Giải trình tự gen KIT trên mô u vùi nến  Khảo sát đột biến gen KIT của 93 trường hợp  UMĐĐTH  ghi  nhận  tỷ  lệ  đột  biến  gen KIT  là  62,4%.  Bảng 2: So sánh kết quả đột biến với các tác giả khác.  NC này Lasota(49) Tzen(21) Corless(6) Có đột biến 61,3% 56% 68,7% 85% Không đột biến 38,7% 44% 31,3% 15% Tỉ lệ phát hiện đột biến gen KIT thay đổi tùy  theo  các  nghiên  cứu,  khoảng  20‐85%(6).  Thông  thường tỷ lệ đột biến trên mẫu mô vùi nến thấp  hơn so với mô tươi và tỉ lệ phát hiện đột biến tỉ  lệ  nghịch  với  “số  tuổi”  của mẫu mô  vùi  nến.  Nguyên  nhân  có  thể  do  hiện  tượng  thoái  hóa  của DNA  theo  thời gian  lưu  trữ  trong paraffin.  Nghiên  cứu Andersson  ghi nhận  đột  biến  gen  trên những khối mô vùi nến có tuổi thọ trên 15  năm có tỷ lệ đột biến thấp, 32% so với các khối  mô vùi nến có “tuổi thọ” dưới 5 năm có tỷ lệ đột  biến 67%(1).  Tỷ lệ đột biến giữa các exon  Trong 57 trường hợp có đột biến, 51 trường  hợp đột biến ở exon 11, chiếm 54,8% và là vị trí  đột biến thường gặp nhất. Các exon còn lại có tỷ  lệ đột biến thay đổi (Bảng 3).  Bảng 3: So sánh tỷ lệ các vị trí đột biến của gen KIT.  Các nghiên cứu Tỷ lệ phần trăm đột biến của gen KIT (%) Tổng tỷ lệ % đột biến Exon 9 Exon 11 Exon 13 Exon 17 Nghiên cứu này 2,2 54,8 0 4,3 61,3 Antonescu(3) 11 67 0 0 78 Lasota(16) 3 52 1 0 56 Hostein(11) 11 67,5 0,9 0,5 79,9 Trong  tất  cả  các nghiên  cứu về UMĐĐTH,  đột biến exon 11  thường gặp nhất,  tiếp  theo  là  đột biến exon 9, 13 hoặc 17. Phân  loại đột biến  cũng  rất  đa dạng, bao gồm  đột biến  điểm,  đột  biến mất đoạn, đột biến chèn đoạn và đột biến  phức tạp(3,11,16).  Bảng 4: Đối chiếu đặc điểm giải phẫu bệnh và vị trí đột biến.  Đặc điểm Có đột biến Exon 11 (n = 51) (%) Các exon khác (n = 6) (%) Vị trí Dạ dày 32 (62,7) 2 (33,3) Ruột non 14 (27,5) 3 (50,0) Vị trí khác 5 (9,8) 1 (16,7) Kích thước u: <5 cm 17 (33,3) 2 (33,3) 5-10 cm 15 (29,4) 1 (16,7) >10 cm 19 (37,3) 3 (50,0) * Loại tế bào Hình thoi Dạng biểu mô Hỗn hợp 39 (76,5) 6 (11,8) 6 (11,8) 6 (100)** 0 0 Chỉ số phân bào: <5 PB/50 QTL 22 (43,1) 3 (50,0) 5-10 PB/50 QTL 11 (21,6) 1 (16,7) >10 PB/50 QTL 18 (35,3) 2 (33,4)*** Phân độ tiềm năng ác tính Thấp+ rất thấp 11 (21,6) 3(50,0) Trung bình 12 (23,5) 0 Cao 28 (54,9) 3 (50,0) **** Giai đoạn: Khu trú 30 (58,9) 4 (66,7) Lan rộng 21 (41,2) 2 (33,3) Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013  Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh  47 Đặc điểm Có đột biến Exon 11 (n = 51) (%) Các exon khác (n = 6) (%) Loại đột biến Điểm Mất đoạn Chèn đoạn Phức tạp 18 (35,2) 23 (45,1) 3 (5,9) 7 (13,8) 4 (66,7) (exon 17) 0 2 (33,3) (exon 9) 0 * 1 trường hợp exon 9 và 2 trường hợp exon 17. ** 2 trường hợp exon 9, 4 trường hợp exon 17.  *** 2 trường hợp exon 9. **** 2 trường hợp exon 9 và 1 trường hợp exon 17.  Đột biến exon 11 của gen KIT được ghi nhận  ở mọi vị trí u khác nhau trên đường tiêu hóa từ  thực quản đến ống hậu môn(2,14). Nghiên cứu này  ghi nhân đột biến exon 11 ưu thế ở dạ dày, loại  tế  bào  hình  thoi,  thường  có  tiềm  năng  ác  tính  cao, kiểu đột biến mất đoạn chiếm ưu  thế. Kết  quả  này  cũng  tương  tự  một  số  nghiên  cứu  khác(6,15).  Bảng 5: Tỷ lệ các loại đột biến trong nghiên cứu này.  Loại đột biến Exon 11 (%) Exon 9 (%) Exon 13 (%) Exon 17 (%) Điểm 18 (31,6) _ _ 4 (7,0) Mất đoạn 23 (40,4) _ _ _ Chèn đoạn 3 (5,2) 2 (3,5) _ _ Phức tạp 7 (12,3) _ _ _ Tổng (100%) 51 (89,5) 2 (3,5) _ 4 (7,0) Khoảng  60‐70%  đột biến  exon  11  của gen  KIT  là  đột  biến  mất  một  hoặc  vài  bộ  mã,  thường là mất trong khoảng từ bộ mã 550 đến  bộ mã 560(19). Đột biến mất đoạn exon 11, đặc  biệt  ở  các  bộ mã  557‐558  có  bệnh  cảnh  lâm  sàng  tiến  triển,  nguy  cơ  tái  phát  và  di  căn  cao(6,15).  Nghiên  cứu  này  ghi  nhận  tất  cả  23  trường  hợp  bị  mất  đoạn  trên  exon  11  nằm  trong  khoảng  mã  550–560,  trong  đó  có  16  trường hợp mất đoạn ở các bộ mã 557‐558 với  tiềm năng ác  tính cao chiếm  tỷ  lệ 68,8%, 50%  bệnh đã lan rộng sang các cơ quan khác.  Đột  biến  điểm  thay  thế  bộ mã  ở  exon  11  chiếm  tỷ  lệ  20‐30%,  đứng  thứ  2  sau  đột  biến  mất  đoạn,  thường  liên  quan  đến  3  bộ  mã  Trp557,  Val559  và  Val560  ở  phần  gần  và  bộ mã  Leu576 ở phần xa của exon 11. Nghiên cứu này  ghi  nhận  mã  đột  biến  điểm  trên  exon  11  thường  gặp  nhất  là  bộ mã  559,  chiếm  44,4%  (Bảng 6).  Bảng 6: Tỷ lệ các mã đột biến điểm trên exon 11  trong nghiên cứu này.  Mã đột biến Số bệnh nhân Tỷ lệ % 557 3 16,7 559 8 44,4 560 2 11,1 Các mã khác 5 27,8 Tổng 18 100 Trên cùng một bộ mã với các kiểu đột biến  điểm khác nhau có thể gây ra các biến đổi chức  năng  sinh  học  khác  nhau. Nghiên  cứu  in vitro  trên mẫu UMĐĐTH có đột biến điểm hiếm gặp  Val559Ile  ghi  nhận  đề  kháng  với  Imatinib,  ngược  lại  đột  biến  thường  gặp Val559‐Asp  lại  nhạy với Imatinib(22). Nghiên cứu của chúng tôi  không ghi nhận cả 2 loại đột biến này.  Bảng 7: Tương quan giữa đột biến điểm và đột biến  mất đoạn của exon 11 với tiềm năng ác tính.  Tiềm năng ác tính thấp và trung bình Tiềm năng ác tính cao Tổng P Điểm 13 (72,2) 5 (27,8) 18 0,008 Mất đoạn 7 (3) 16 (70) 23 Đa  số  các  trường  hợp  đột  biến mất  đoạn  exon  11  có  tiềm  năng  ác  tính  cao  (p  =  0,008<  0,05).  Nghiên  cứu  của  Singer  ghi  nhận  tiên  lượng  sống  5  năm  không  tái  phát  của  9  bệnh  nhân  UMĐĐTH  có  đột  biến  điểm  exon  11  là  78%‐100%,  so với  39  trường hợp  đột  biến mất  đoạn exon 11, tiên lượng sống vào khoảng 32%‐ 48%. Wardelmann cũng ghi nhận 21 trường hợp  sống không bệnh với đột biến mất đoạn exon 11  liên quan với các bộ mã Trp557 và/hoặc Lys558  so với 34 TH u có các kiểu đột biến khác ở exon  11 hoặc KIT WT(1).  Đột biến chèn đoạn exon 11 là loại đột biến  rất hiếm gặp  trên gen KIT mặc dù  ưu  thế  trên  exon 11 so với các exon khác, đặc biệt ở bộ mã  558(16). Nghiên cứu này ghi nhận 3  trường hợp  đột  biến  chèn  đoạn  trên  exon  11  trong  đó  2  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Phụ bản của Số 3 * 2013 Chuyên Đề Giải Phẫu Bệnh  48 trường hợp có tiềm năng ác tính cao và 1 trường  hợp có tiềm năng ác tính trung bình.  Tỷ  lệ  các  loại  đột  biến  trên  exon  11  trong  nghiên  cứu này  tương  tự  các nghiên  cứu khác  (Bảng 8).  Bảng 8: So sánh tỷ lệ các loại đột biến trên exon 11.  Kiểu đột biến exon 11 Nghiên cứu này Antonescu (3) Andersson(1) Điểm 18 (31,6%) 22 (18%) 23 (13%) Mất đoạn 23 (40,4%) 38 (31%) 61 (34%) Chèn đoạn 3 (5,2%) 8 (7%) 17 (10%) Phức tạp 7 (12,3%) 13 (11%) (Đột biến điểm và mất đoạn) _ Exon 9 là đoạn cuối của phần gen KIT ngoài  tế bào, đây là vị trí đột biến gen KIT thường gặp  thứ 2, chiếm tỷ lệ 5‐13%. Hầu hết đột biến exon 9  là loại đột biến nhân đôi cặp mã Ala502‐Tyr503 và  là đột biến đặc trưng của u mô đệm đường tiêu  hóa ở ruột. Hầu hết u mô đệm đường  tiêu hóa  xảy ra ở ruột non có loại đột biến trên đều diễn  tiến ác tính(15). Trong nghiên cứu này có 2 trường  hợp  kiểu  đột  biến  chèn  đoạn  exon  9  pY503‐ F504insAY trong đó có một trường hợp đã được  đề cập ở trên: Bệnh nhân Trương Bích L., 60 tuổi,  MSGPB: Y11‐16197. Cả 2 trường hợp này đều có  bệnh cảnh lâm sàng tiến triển, u ruột non, tiềm  năng ác tính cao, di căn gan hoặc phúc mạc. Đột  biến exon 9 kém nhạy với  imatinib so với exon  11 (đáp ứng 50%), liều điều trị được khuyến cáo  là 800mg/ngày  thay vì 400 mg/ngày, hoặc  thay  bằng sunitinib(5). Nghiên cứu của Antonescu ghi  nhận cả 10 trường hợp đột biến chèn đoạn exon  9 xảy ra ở ruột non, sau 1 năm chẩn đoán, bệnh  di căn ổ bụng hoặc di căn xa, đặc điểm giải phẫu  bệnh ghi nhận u nằm ngoài dạ dày, kích thước  lớn và hình thái tế bào loại hình thoi(3).  Đột biến exon 13 phần  lớn  là  loại thay thế  một  nucleotide  1945A  →  G  làm  thay  đổi  Lys642Glu  ở mức  độ  protein.  Tuy  nhiên,  các  nghiên  cứu  gần  đây  ghi  nhận  đột  biến  điểm  exon  13  cũng  khá  đa  dạng,  gồm  6  loại  khác  nhau:  Glu635Lys,  Leu641Pro,  Val643Ala,  Leu647Pro, Met651Val và Asn655Lys. Loại đột  biến  điểm Lys642Glu và Asn655Lys gây hoạt  hóa  cấu  trúc phosphoryl  của TK và nhạy với  imatinib(9).  Nghiên  cứu  này  không  ghi  nhận  đột biến exon 13.  Hầu hết đột biến gen KIT exon 17 là đột biến  điểm 2487T→A làm biến đổi Asn822Lys ở mức  độ  protein. UMĐĐTH  ở  ruột  non  có  đột  biến  gen  KIT  ở  exon  17  nhiều  gấp  hai  lần  so  với  UMĐĐTH  ở dạ dày.  Đột biến  exon  17 N822K  kháng imatinib(2,9,15,17). Nghiên cứu của chúng tôi  ghi nhận 3 trong 4 trường hợp đột biến exon 17  có kiểu đột biến N822K, bệnh nhân cần được lựa  chọn một mô thức điều trị thích hợp khác ngoài  loại thuốc này.  Bảng 9: Liên quan kiểu đột biến KIT với mức độ nhạy imatinib trên thực nghiệm và đáp ứng với imatinib trong  điều trị theo các nghiên cứu th
Tài liệu liên quan