Phát triển kỹ thuật Multiplex real time PCR sử dụng Taqman probe cải tiến để phát hiện HPV nguy cơ thấp type 6 và 11 với độ đặc hiệu và độ nhạy cao

Human papillomavirus (HPV) là tác nhân gây bệnh phổ biến lây nhiễm qua đường tình dục, gồm nhiều sub-type được phân thành nhóm nguy cơ cao gây ung thư và nhóm nguy cơ thấp gây các bệnh lý về da và niêm mạc với tỷ lệ nhiễm và khả năng tái phát cao. Trên thị trường đã có sinh phẩm nhập ngoại để phát hiện một số type Human papillomavirus nguy cơ thấp, tuy nhiên giá thành cao nên khó triển khai thành kít sàng lọc trong cộng đồng. Trong nghiên cứu này, chúng tôi xây dựng phương pháp mới với chi phí thấp hơn, giúp phát hiện 2 type Human papillomavirus nguy cơ thấp thường gặp nhất là Human papillomavirus 6 và Human papillomavirus 11 với độ nhạy 5 copy/phản ứng 25 µL bằng kỹ thuật multiplex real time PCR sử dụng Taqman probe cải tiến có gắn thêm ZEN quencher gần đầu 5-huỳnh quang HEX, song song với phát hiện gen nội chuẩn β-actin bằng Texas-Red Taqman probe. Kết quả so sánh trên 30 mẫu dịch âm đạo với sinh phẩm thương mại có uy tín cho kết quả tương đồng về tỷ lệ mẫu dương tính và chu kỳ ngưỡng phát hiện Human papillomavirus 6/11.

pdf12 trang | Chia sẻ: thuyduongbt11 | Ngày: 14/06/2022 | Lượt xem: 220 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phát triển kỹ thuật Multiplex real time PCR sử dụng Taqman probe cải tiến để phát hiện HPV nguy cơ thấp type 6 và 11 với độ đặc hiệu và độ nhạy cao, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
TCNCYH 115 (6) - 2018 61 TẠP CHÍ NGHIÊN CỨU Y HỌC PHÁT TRIỂN KỸ THUẬT MULTIPLEX REAL TIME PCR SỬ DỤNG TAQMAN PROBE CẢI TIẾN ĐỂ PHÁT HIỆN HPV NGUY CƠ THẤP TYPE 6 VÀ 11 VỚI ĐỘ ĐẶC HIỆU VÀ ĐỘ NHẠY CAO Trần Thị Ngọc Ánh1,2#, Ngô Thị Hồng1,2,3#, Chu Văn Sơn1, Trần Dụ Chi4,5, Bùi Thị Việt Hà1,2, Nguyễn Thị Vân Anh1* *Tác giả liên hệ; #:Đồng tác giả thứ nhất 1Phòng Thí nghiệm trọng điểm Công nghệ Enzyme và Protein, Trường Đại học Khoa học Tự nhiên, Đại học Quốc gia Hà Nội; 2Khoa Sinh học, Trường Đại học Khoa học Tự nhiên, Đại học Quốc Gia Hà Nội 3Trung tâm Kiểm soát bệnh tật tỉnh Bắc Ninh, Thành phố Bắc Ninh 4Bệnh viện Da liễu Trung ương; 5Bệnh viện Đa khoa Quốc tế Vinmec Human papillomavirus (HPV) là tác nhân gây bệnh phổ biến lây nhiễm qua đường tình dục, gồm nhiều sub-type được phân thành nhóm nguy cơ cao gây ung thư và nhóm nguy cơ thấp gây các bệnh lý về da và niêm mạc với tỷ lệ nhiễm và khả năng tái phát cao. Trên thị trường đã có sinh phẩm nhập ngoại để phát hiện một số type Human papillomavirus nguy cơ thấp, tuy nhiên giá thành cao nên khó triển khai thành kít sàng lọc trong cộng đồng. Trong nghiên cứu này, chúng tôi xây dựng phương pháp mới với chi phí thấp hơn, giúp phát hiện 2 type Human papillomavirus nguy cơ thấp thường gặp nhất là Human papillomavirus 6 và Human papillomavirus 11 với độ nhạy 5 copy/phản ứng 25 µL bằng kỹ thuật multiplex real time PCR sử dụng Taqman probe cải tiến có gắn thêm ZEN quencher gần đầu 5-huỳnh quang HEX, song song với phát hiện gen nội chuẩn β-actin bằng Texas-Red Taqman probe. Kết quả so sánh trên 30 mẫu dịch âm đạo với sinh phẩm thương mại có uy tín cho kết quả tương đồng về tỷ lệ mẫu dương tính và chu kỳ ngưỡng phát hiện Human papillomavirus 6/11. Từ khoá: HPV, nguy cơ thấp, real time PCR Taqman, dịch âm đạo Địa chỉ liên hệ: Nguyễn Thị Vân Anh, Trường Đại học Khoa học Tự nhiên Email: vananhbiolab@gmail.com Ngày nhận: 30/7/2018 Ngày được chấp thuận: 04/9/2018 I. ĐẶT VẤN ĐỀ Human papiloma virus (HPV) là một trong những tác nhân gây bệnh quan trọng lây nhiễm qua đường tình dục ở cả nam và nữ trên toàn thế giới và được cho là bệnh truyền nhiễm qua đường tình dục phổ biến nhất ở Hoa Kỳ [1]. Các type Human papillomavirus 16 và 18 và 12 type khác như 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 đã được nghiên cứu và chứng minh có nguy cơ cao gây bệnh ung thư cổ tử cung [2,3,4]. Ngoài các type có nguy cơ cao, một số type nguy cơ thấp được công nhận là nguyên nhân gây ra các tổn thương lành tính trên da (mụn cơm, mụn cóc thông thường, mụn cơm phẳng). Hai type HPV nguy cơ thấp 6 và 11 là nguyên nhân của 90% các bệnh lý về da [5]. Nhiễm trùng papillomatosis chủ yếu gặp ở trẻ nhỏ được sinh ra từ những bà mẹ có tiền sử nhiễm HPV trong giai đoạn chu sinh [6 - 8]. Những tổn thương này có thể chuyển đổi thành ác tính [9]. Nhiễm trùng HPV thường không biểu hiện lâm sàng nên không thể có thống kê chính xác số lượng người nhiễm trên toàn thế giới. Ước tính trên thế giới, hàng năm, HPV gây ra mụn cóc sinh dục cho 0,1 - 0,2% dân số, chủ yếu ở tuổi vị thành niên, thanh thiếu niên [10]. Các type này rất dễ lây truyền qua tiếp xúc (da, niêm mạc, dịch tiết có virus). Do đó, việc chẩn 62 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC đoán sàng lọc tại cộng đồng HPV 6 và 11 cũng góp phần quan trọng để phòng tránh lây nhiễm, đặc biệt là cho trẻ sơ sinh. Hiện nay, phương pháp hiệu quả nhất để chẩn đoán HPV là dựa vào vật liệu di truyền (kỹ thuật PCR/real time PCR). Trên thế giới, đã có công bố của một vài tác giả về phát triển kỹ thuật multiplex real time PCR để phát hiện đồng thời một số type nguy cơ cao và nguy cơ thấp trong sàng lọc HPV ở các mẫu dịch âm đạo. Điển hình là công bố của tác giả Lindh và cộng sự (2007) về phát hiện 12 type HPV nguy cơ cao và 2 type nguy cơ thấp HPV 6/11 đồng thời trên cùng một chu trình nhiệt [11]. Tuy nhiên, hạn chế của nghiên cứu là sử dụng Taqman probe thông thường có huỳnh quang TAMRA ở đầu 3’ nên tín hiệu nền còn cao và chưa tối ưu được master mix để phát hiện của 14 type trong cùng 1 ống phản ứng mà vẫn phải thực hiện 14 ống phản ứng riêng rẽ cho mỗi mẫu. Một hạn chế khác là chưa có thông tin tối ưu về độ nhạy và độ đặc hiệu của phản ứng. Nghiên cứu của tác giả Seaman và cộng sự (2010) có cải tiến hơn trong việc phát triển được kỹ thuật multiplex real time PCR phát hiện đồng thời HPV 16, 18 và 2 type HPV nguy cơ thấp 6, 11 [12]. Tuy nhiên, độ nhạy của ngưỡng phát hiện chỉ đạt 103 copy/phản ứng 25 µL, một phần do sử dụng Taqman probe thông thường có BHQ1 quencher ở đầu 3’. Tác giả Yu và cộng sự (năm 2012) đã sử dụng probe huỳnh quang AllGlo để phát hiện đồng thời 4 type HPV 6, 11, 16, 18 với độ nhạy 10 copy/phản ứng 25 µL [13]. Trên thị trường có bộ kít phát hiện HPV type 6 và 11 nguy cơ thấp HPV 6/11 Real-TM (Sacace Biotechnologies, Ý) có độ nhạy đạt tới 2,5 copy/phản ứng 25 µL nhưng thành phần và công thức chưa được công bố. Ngoài ra, giá thành sinh phẩm nhập ngoại cao (178.000 VNĐ/ phản ứng) nên khó khăn khi triển khai thành xét nghiệm sàng lọc tại cộng đồng. Ở trong nước, chúng tôi chưa tìm thấy thông tin về nghiên cứu phát triển phương pháp hay bộ sinh phẩm phát hiện các type HPV nguy cơ thấp mà mới chỉ có thông tin về các bộ sinh phẩm phát hiện các type HPV nguy cơ cao. Do vậy, trong nghiên cứu này, chúng tôi đặt mục tiêu bước đầu phát triển phương pháp multiplex real time PCR sử dụng Taqman probe cải tiến gắn thêm ZEN quencher để phát hiện 2 type HPV nguy cơ thấp thường gặp nhất là HPV 6 và HPV 11 có độ đặc hiệu 100% và độ nhạy đạt tới ≤ 5 copy phản ứng 25 µL. Kết quả của nghiên cứu là tiền đề cho việc phát triển phương pháp phát hiện đồng thời các type HPV nguy cơ cao và nguy cơ thấp trong tương lai, hướng tới việc chế tạo bộ sinh phẩm có chất lượng tương đương và giá thành cạnh tranh so với bộ sinh phẩm thương mại có uy tín trên thị trường. Nhờ đó, góp phần tầm soát tỷ lệ nhiễm HPV và đánh giá hiệu quả vacxin. II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP 1. Đối tượng Mẫu tham chiếu dùng để xây dựng phương pháp: + Mẫu HPV: các mẫu DNA được tinh sạch và xác định dương tính với các HPV genotypes khác nhau. Trong đó có 14 type HPV nguy cơ cao phổ biến (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68) do bệnh viện Phụ Sản Trung ương cung cấp đã được xác định đồng thời bằng kit thương mại Real time Cobas®HPV test của hãng Roche Diagnostics - Thuỵ Sỹ và GenoFlow human papillomavirus array test (GF test) của hãng Diagcor - Hồng Kông và có 2 type nguy cơ TCNCYH 115 (6) - 2018 63 TẠP CHÍ NGHIÊN CỨU Y HỌC thấp (HPV 6, 11) do bệnh viện Da liễu Trung ương cung cấp đã được xác định đồng thời GF test (Diagcor – Hồng Kông) và HPV 6/11 Real-TM của hãng Saccase – Ý. Các mẫu được lựa chọn có giá trị chu kỳ ngưỡng (Ct) ≤ 32 để đảm bảo nồng độ DNA ≥ 103 copies/µ l, tương đương với nồng độ chuẩn dương hay được sử dụng trong các kit thương mai. DNA của các mẫu tham chiếu được sử dụng làm khuôn để nhân bản trình tự đặc hiệu bằng PCR sử dụng cặp mồi GP5+/6+ (theo khuyến cáo của CDC) và giải trình tự DNA để khẳng định type. + Mẫu nhiễm các vi sinh vật gây bệnh khác: các mẫu DNA dương tính với các tác nhân gây bệnh bao gồm: Hepatitis B virus (HBV), Hepatitis C virus (HCV), Human Simplex virus type 1 - 2 (HSV), cytomegalovirus (CMV), Mycobacterium tuberculosis (MTB), Epstein - Barr virus (EBV), Mycoplasma hominis, Mycoplasma genitalium do Bệnh viện Bạch Mai, Học Viện Quân Y và Bệnh viện Da liễu Trung ương cung cấp. Mẫu HBV, HCV và HSV type 1 - 2 được xác định bằng các kít thương mại (Real time PCR Cobas®HBV test, Real time PCR Cobas®HCV test, Cobas®HSV 1 and 2 test của hãng Roche Diagnostics - Thuỵ Sỹ; mẫu CMV được xác định bởi Real time PCR ANAPURE® CMV qPCR, mẫu MTB được xác định bởi ANAPURE® MTB qPCR, mẫu EBV được xác định bởi ANAPURE® EBV qPCR, ANAPURE®, mẫu M. hominis và M. genitalium được xác định đồng thời bởi Mycoplasma homi-geni qPCR của hãng ANABIO R&D - Vietnam, và Diagcor STD array test - Hồng Kông). Các mẫu được lựa có giá trị Ct thấp nhất có thể và đạt yêu cầu Ct ≤ 32, để đảm bảo nồng độ DNA của các vi sinh vật nhiễm được sử dụng là khá cao, tối thiểu là 103 copies/µl. Mẫu thử nghiệm: Mẫu bệnh phẩm (n = 95) được lấy từ dịch âm đạo của bệnh nhân và được bảo quản trong dung dịch nước muối sinh lý đã khử trùng. Mẫu được sử dụng ngay để tách chiết DNA tổng số và DNA được sử dụng ngay hoặc được bảo quản ở -80oC trước khi tiến hành real time PCR. Mẫu được thu thập theo phương pháp chọn mẫu thuận tiện, tại Trung tâm kiểm soát bệnh tật tỉnh Bắc Ninh từ năm 2017 đến 2018. Tiêu chuẩn lựa chọn bệnh nhân là phụ nữ trong độ tuổi từ 18 - 65 tuổi, đến khám và tự nguyện tham gia nghiên cứu; tiêu chuẩn loại trừ là những bệnh nhân đã cắt cổ tử cung hoàn toàn, đang trong thời kỳ kinh nguyệt, viêm nhiễm nặng và đang đặt thuốc. Nghiên cứu được phê duyệt bởi hội đồng khoa học, trên cơ sở quyết định số 1124/QĐ-ĐHKHTN của Trường Đại học Khoa học Tự nhiên, và được thực hiện theo đúng đạo đức nghiên cứu trong Y học. Bệnh nhân được cung cấp đầy đủ thông tin về nghiên cứu, được bảo mật thông tin cá nhân và ký vào phiếu đồng thuận tham gia nghiên cứu. 2. Phương pháp 2.1. Thiết kế primer và probe cho phản ứng real time PCR phát hiện đồng thời type HPV 6 và HPV 11 Hai cặp mồi và probe sử dụng trong nghiên cứu này được thiết kế sử dụng IDT’s PrimerQuest kết hợp với phần mềm SnapGen version 4.1.3 dựa vào trình tự vùng gen E6-E7 đặc hiệu cho HPV 6 (Acession No. HG793938.1), trình tự vùng gen E1 đặc hiệu cho HPV 11 (Acession No. JQ773411.1) được công bố trên ngân hàng gen NCBI. Hai trình tự probe đặc hiệu cho HPV 6 và HPV 11 được cải tiến gắn thêm ZEN quencher dye tại oligonucleotide thứ 9 gần đầu 5’-huỳnh quang HEX để tăng khả năng hấp thụ hay dập tắt tín 64 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC hiệu của HEX khi probe chưa gắn vào khuôn, nhờ đó tín hiệu nền giảm và độ nhạy của phản ứng được tăng lên. Cặp mồi và probe đặc hiệu cho human β-actin (ACTB) được thiết kế theo công bố của Nguyen và cộng sự [14]. Mồi và probe được tổng hợp bởi hãng IDT (Hoa Kỳ) và được trình bày ở bảng 1. Bảng 1. Các cặp mồi và probe đặc hiệu cho HPV 6 và HPV 11 Mồi/ mẫu dò Trình tự (5’ - 3’) Gen đích Kích thước (bp) Lượng (pmol/ pứ) 6-Fw CCGCTGTGTGAAGTAGAAAAGGTAAA E6, E7 165 5 6-Rv CTACAGGGTCTGGAGGTTGC 5 6-HEX probe /5HEX/AAGGGTCGC/ZEN/TGCCTACACTGCT GG/3IABkFQ/ 1 11-Fw GCAAGTACAGTTATAGGGGAGG E1 174 5 11-Rv GTCAAAGTCTCCACGCTG 5 11-HEX probe /5HEX/CGGAATGG A/ZEN/TAAC GCGCCA GACCG/3IABkFQ/ 1 ACTB-Fw GATGTCCACGTCACACTTCA β-actin 115 3 ACTB-Rv ATGCCTGAGAGGGAAATGAGGGC 3 ACTB- Texas probe /5TexasRed/ATGCCTGAGAGGGAAATGAGG GC/3BHQ2/ 2 2.2. Tách chiết DNA của HPV và nhân dòng tạo chuẩn dương chứa trình tự đặc hiệu của HPV 6 và HPV 11 DNA tổng số của virus được tách chiết từ mẫu bệnh phẩm dịch âm đạo sử dụng bộ sinh phẩm ANAPURE VIRAL DNA/RNA mini kit (ANABIO R & D, Việt Nam) theo hướng dẫn của nhà sản xuất, sau đó được lưu trữ ở - 20oC cho các phản ứng PCR và real time PCR. DNA sau tinh sạch từ mẫu tham chiếu dương tính HPV 6 và HPV 11 được sử dụng làm khuôn cho phản ứng PCR nhân bản trình tự gen đặc hiệu E6 - E7 và E1 kích thước tương ứng 165 bp và 174 bp của HPV 6 và HPV 11. Thành phần phản ứng PCR gồm 1X Hot - Taq Buffer; 0,2 mM dNTP; 1U Hot - Taq; 400 nM 6/11 Rv/Fw và H2O cho thể tích 25 µl. Phản ứng PCR được thực hiện với chế độ nhiệt 950C - 5 phút; 45 chu kỳ gồm các bước: 950C - 30 giây, 600C - 30 giây, 720C - 30 giây; 720C - 5 phút. Các sản phẩm PCR được kiểm tra bằng điện di trên gel agarose 2%, nhuộm Ethidium bromide và chụp ảnh bằng hệ thống Gel Doc XR (Biorad). Sản phẩm PCR 165 bp đặc hiệu cho HPV 6 và 174 bp đặc hiệu cho HPV 11 được nhân dòng trực tiếp vào vector pTOP sử dụng bộ sinh phẩm TOPcloner ™ TA Kit (Enzynomics, TCNCYH 115 (6) - 2018 65 TẠP CHÍ NGHIÊN CỨU Y HỌC Hàn Quốc). Plasmid tái tổ hợp mang đoạn chèn 165 bp và 174 bp được được biến nạp vào E. coli DH5 α, sau đó nuôi cấy trên môi trường LB đặc bổ sung ampicillin 50 mg/L, rồi tiến hành chọn lọc khuẩn lạc xanh-trắng và sàng lọc bằng colony - PCR sử dụng cặp mồi vector M13 - Fw/Rv (đi kèm bộ sinh phẩm) và mồi đặc hiệu 6, 11 - Fw/Rv. Khuẩn lạc tái tổ hợp được sử dụng để tách plasmid để làm chuẩn dương cho phản ứng real time PCR phát hiện HPV 6 và HPV 11 và được đặt tên tương ứng là pHPV6 - E6/7 và pHPV11 - E1. 2.3. Xác định ngưỡng phát hiện của phản ứng và tối ưu nồng độ của chuẩn dương Plasmid tái tổ hợp pHPV6-E6/7 và pHPV11 - E1 sau khi tinh sạch được xác định nồng độ ở bước sóng 260 nm bằng máy quang phổ Nanodrop. Xác định ngưỡng phát hiện của kỹ thuật multiplex real time PCR bằng cách pha loãng nồng độ khuôn plasmid pHPV6 - E6/7, pHPV11 - E1 và hỗn hợp 2 plasmid tỷ lệ 1: 1 ở dải nồng độ 103, 102, 10, 1 copies/µl. 5 µl DNA khuôn được bổ sung vào 20 µl mas- ter mix của multiplex real time PCR gồm: TO- Preal Taqman PCR master mix 1X (Enzynomics); 250 nM 6, 11 - Rv/Fw; 250 nM 11- Rv/ Fw; 50 nM 6, 11 - HEX probe; 150 nM ACTB Rv/Fw; 100 nM ACTB- probe và H2O để đạt tổng thể tích là 25 µl. Phản ứng được thực hiện với chu trình nhiệt là 950C - 10 phút; 45 chu kỳ gồm 95oC - 10 giây; 600C - 45 giây trên hệ thống Light Cycler 96 (Roche Diagnos- tics). Ngưỡng phát hiện là nồng độ thấp nhất của chứng dương pHPV6 - E6/7 và pHPV11 - E1 trong ống phản ứng mà vẫn phát hiện được tín hiệu huỳnh quang với giá trị Ct < 40, được tính bằng giá trị copies/µl DNA khuôn đầu vào x 5). 2.4. Xác định độ đặc hiệu Độ đặc hiệu của multiplex real time PCR nêu trên được đánh giá thông qua kết quả dương tính giả (nếu có) khi sử dụng 5 µl DNA mỗi khuôn ở nồng độ tối thiểu là 103 copies/µl của 14 type HPV nguy cơ cao phổ biến gồm HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, và của một số vi sinh vật gây bệnh truyền nhiễm khác gồm HBV, HCV, HSV, CMV, MTB, EBV, Mycoplasma hominis, M. genitalium bổ sung vào hỗn hợp 20 µl master mix có thành phần được mô tả trong mục 2.3. Phản ứng được thực hiện với chu trình nhiệt giống như áp dụng cho type HPV 6 và 11, được mô tả trong mục 2.3. 2.5. Thử nghiệm phát hiện HPV 6 và HPV 11 trên mẫu bệnh phẩm và so sánh độ tương đồng với sinh phẩm thương mại Tổng cộng 95 mẫu được sử dụng để thử nghiệm phát hiện HPV 6 và HPV 11 bởi master mix chế tạo và chu trình nhiệt thiết lập trong nghiên cứu này. Trong đó, 30 mẫu gồm 10 mẫu dương tính và 20 mẫu âm tính với HPV 6 và 11 được sử dụng để so sánh tương đồng (tỷ lệ dương tính/âm tính) và độ nhạy (Ct) giữa sinh phẩm tạo thành trong nghiên cứu và sinh phẩm thương mại HPV 6/11 REAL-TM (Sacace Biotechnologies, Ý). Toàn bộ thí nghiệm từ mục 2.1 đến 2.4 được thực hiện tại Phòng Thí nghiệm trọng điểm Công nghệ Enzym và Protein, Trường Đại học Khoa học Tự nhiên từ năm 2017 đến 2018. Thí nghiệm ở mục 2.5 được thực hiện tại cả Khoa Xét nghiệm - Chẩn đoán hình ảnh - Thăm dò chức năng của Trung tâm Kiểm soát Bệnh tật tỉnh Bắc Ninh và Phòng Thí nghiệm Trọng điểm Công nghệ Enzym và Protein, Trường Đại học Khoa học Tự nhiên trong năm 2018. 66 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC III. KẾT QUẢ 1. Vector mang chuẩn dương HPV 6 và HPV 11 Trong nghiên cứu này, đoạn gen đặc hiệu cho vùng E6 - 7 của HPV 6 có kích thước 165 bp và đoạn gen đặc hiệu cho vùng E1 của HPV 11 có kích thước 174 bp được khuếch đại bằng phản ứng PCR với cặp mồi đặc hiệu. Kết quả trình bày ở Hình 1A cho thấy: sản phẩm PCR với cặp mồi 6 - Fw và 6 - Rv cho duy nhất một băng sắc nét với kích thước tương ứng là 165 bp (giếng 3); tương tự, sản phẩm PCR với cặp mồi HPV 11 cho một băng rõ nét có kích thước 174 bp (giếng 4). Hai băng này sau đó được tinh sạch và đem giải trình tự. Kết quả giải trình tự trùng khớp với trình tư gen E6-7 của HPV 6 và trình tự gen E1 của HPV 11 (không trình bày ở đây). Sản phẩm PCR sau đó được nhân dòng vào vector pTOP TA V2 sử dụng bộ sinh phẩm TOPcloner™ TA Kit (Enzynomics, Hàn Quốc) và khuẩn lạc tái tổ hợp được khẳng định bằng phương pháp colony - PCR sử dụng cặp mồi vector M13 - Fw/Rv (đi kèm bộ sinh phẩm) và mồi đặc hiệu 6, 11 - Fw/Rv. Kết quả trình bày trên hình ảnh điện di ở giếng 6 (hình 1B) và giếng 2 (hình 1C) cho thấy kích thước băng điện di là 165 bp và 174 bp đúng với kích thước đoạn gen đặc hiệu của vector tái tổ hợp HPV6 - E6/7 và HPV11 - E1. Để khẳng định chắc chắn khuẩn lạc tái tổ hợp chứa gen đặc hiệu của HPV 6 và HPV 11, chúng tôi sử dụng cặp mồi vector M13 Rv/Fw cho kích thước đoạn gen khuếch đại được bằng tổng kích thước đoạn gen mồi M13 nhân lên (202 bp) cộng với kích thước đoạn gen đích. Như vậy, kích thước tính toán về mặt lý thuyết khi sử dụng mồi vector cho đoạn gen đích HPV 6 và HPV 11 lần lượt là 367 bp và 376 bp. Đúng như dự đoán, kết quả thể hiện trên hình 1B (giếng 2 - 4) hình 1C (giếng 4 - 6) cho thấy chúng tôi đã nhân dòng thành công plasmid tái tổ hợp pHPV6-E6/7 và pHPV11 - E1. Hình 1. Kết quả điện di sản phẩm PCR nhân bản đoạn gen đặc hiệu HPV6-E6/7 và HPV11- E1 (A) và kiểm tra sản phẩm sau nhân dòng (B, C) (A): Giếng 1: Thang chuẩn DNA 100 bp, giếng 2: Đối chứng âm, giếng 3: sản phẩm PCR của HPV6 - E6/7, giếng 4: sản phẩm PCR của HPV11 - E1; (B): Giếng 1: Đối chứng âm, giếng 2 - 4: Sản phẩm PCR mồi vector M13, giếng 5: Thang chuẩn DNA 100 bp, giếng 6: sản phẩm PCR sử TCNCYH 115 (6) - 2018 67 TẠP CHÍ NGHIÊN CỨU Y HỌC dụng mồi đặc hiệu Fw/Rv - 6; (C): Giếng 1: Đối chứng âm, giếng 4 - 6: Sản phẩm PCR sử dụng mồi vector M13, giếng 3: Thang chuẩn DNA 100 bp, giếng 2: sản phẩm PCR sử dụng mồi đặc hiệu Fw/Rv - 11. 2. Ngưỡng phát hiện HPV 6 và HPV 11 bằng multiplex real time PCR Kết quả đánh giá ngưỡng phát hiện của kỹ thuật multiplex real time PCR phát hiện đồng thời cả HPV 6 và HPV 11 thể hiện ở hình 2 cho thấy tất cả các nồng độ của chứng dương ở dạng đơn lẻ (hình 2A - B) hay hỗn hợp (hình 2C) đều cho kết quả dương tính, giá trị Ct ở các nồng độ pha loãng từ cao đến thấp giảm trung bình 3,2. Ngưỡng phát hiện HPV 6 của phản ứng lên tới 5 copy/phản ứng (1 copy/µl DNA đầu vào x 5 µl khuôn/phản ứng 25 µl) với giá trị R2: 0,993, Efficiency: 93%, slope: -3,34. Tương tự, ngưỡng phát hiện HPV 11 là 5 copy/phản ứng (R2: 0,998, Efficiency: 85%, slope: -3,7) và đồng thời HPV 6,11 cũng lên tới 5 copy/phản ứng (R2: 0,999, Efficiency: 80%, slope: -3,99). Dựa trên kết quả này, ngưỡng phát hiện của kỹ thuật multiplex real time PCR phát hiện đồng thời 2 tác nhân gây bệnh HPV6, 11 được xác định là 5 copy/phản ứng 25 µl (tương đương nồng độ DNA khuôn 1 copy/µl). Hình 2. Đường chuẩn biểu diễn tín hiệu huỳnh quang của phản ứng Real time PCR và đường hồi quy tuyến tính giá trị chu kỳ ngưỡng ở các dải nồng độ chuẩn dương khác nhau: (A1, B1, C1) 68 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC Đường chuẩn Real time PCR biểu diễn tín hiệu khuếch đại chuẩn dương HPV 6 (A1), HPV 11 (B1) và hỗn hợp HPV 6, 11 (C1) ở nồng độ 103, 102, 10,1 copy/µl; (A2, B2, C2). Đường hồi quy tuyến tính giữa giá trị chu kỳ ngưỡng Ct và nồng độ chuẩn dương HPV 6 (A2), HPV 11 (B2) và hỗn hợp HPV 6, 11 (C2). 3. Độ đặc hiệu của multiplex real time PCR phát hiện HPV 6 và HPV 11 Để xác định độ đặc hiệu của real time PCR phát hiện HPV 6 và HPV 11, chúng tôi sử dụng 20 mẫu DNA dương tính với các type HPV nhóm nguy cơ cao (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68) và một số tác nhân khác (HBV, HCV, HSV, CMV, MTB, EBV, Mycoplasma h