Đột biến gen btk trên bệnh nhân thiếu gammaglobulin máu liên kết nhiễm sắc thể X

Giới thiệu: Thiếu gammaglobulin máu liên kết nhiễm sắc thể X (X‐linked agammaglobulinemia (XLA) là một dạng suy giảm miễn dịch tiên phát mà chẩn đoán lâm sàng thường phải phân biệt với nhiều dạng rối loạn miễn dịch khác. Đột biến gen BTK là nguyên nhân gây bệnh trong phần lớn các trường hợp và được xem như một dấu ấn sinh học quan trọng giúp hỗ trợ chẩn đoán cũng như tư vấn di truyền. Mục tiêu: Nghiên cứu này nhằm xây dựng quy trình phát hiện và mô tả các đột biến gen BTK trên bệnh nhân trẻ em Việt Nam bị XLA. Đối tượng và phương pháp: Chúng tôi tiến hành phân tích đột biến gen BTK từ RNA trong máu ngoại vi của 22 bệnh nhân. Toàn bộ vùng mã hóa protein của gen BTK được khuếch đại và giải trình tự chuỗi DNA. Kết quả: Có 13 bệnh nhân mang đột biến gen BTK được phát hiện (59%), gồm 8 đột biến mất đoạn, 4 đột biến điểm và 1 đột biến chèn đoạn. Các đột biến không tập trung mà phân bố rải rác trên khắp chiều dài gen BTK từ exon 2 – 19. Kết luận: Phổ đột biến gen BTK trên bệnh nhân Việt Nam rất đa dạng, cần được khảo sát toàn bộ các vùng của gen này cho trường hợp muốn xác định chẩn đoán XLA.

pdf5 trang | Chia sẻ: thanhuyen291 | Ngày: 14/06/2022 | Lượt xem: 243 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Đột biến gen btk trên bệnh nhân thiếu gammaglobulin máu liên kết nhiễm sắc thể X, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Y Học TP. Hồ Chí Minh * Tập 17 * Số 5 * 2013  Nghiên cứu Y học Chuyên Đề Truyền Máu – Huyết Học  195 ĐỘT BIẾN GEN BTK TRÊN BỆNH NHÂN THIẾU GAMMAGLOBULIN MÁU  LIÊN KẾT NHIỄM SẮC THỂ X  Hoàng Anh Vũ*, Phan Thị Xinh**, Nguyễn Hoàng Mai Anh***, Hoàng Lê Phúc***  TÓM TẮT  Giới thiệu: Thiếu gammaglobulin máu liên kết nhiễm sắc thể X (X‐linked agammaglobulinemia (XLA) là  một dạng suy giảm miễn dịch tiên phát mà chẩn đoán lâm sàng thường phải phân biệt với nhiều dạng rối loạn  miễn dịch khác. Đột biến gen BTK là nguyên nhân gây bệnh trong phần lớn các trường hợp và được xem như  một dấu ấn sinh học quan trọng giúp hỗ trợ chẩn đoán cũng như tư vấn di truyền.  Mục tiêu: Nghiên cứu này nhằm xây dựng quy trình phát hiện và mô tả các đột biến gen BTK trên bệnh  nhân trẻ em Việt Nam bị XLA.  Đối tượng và phương pháp: Chúng tôi tiến hành phân tích đột biến gen BTK từ RNA trong máu ngoại vi  của 22 bệnh nhân. Toàn bộ vùng mã hóa protein của gen BTK được khuếch đại và giải trình tự chuỗi DNA.  Kết quả: Có 13 bệnh nhân mang đột biến gen BTK được phát hiện (59%), gồm 8 đột biến mất đoạn, 4 đột  biến điểm và 1 đột biến chèn đoạn. Các đột biến không tập trung mà phân bố rải rác trên khắp chiều dài gen BTK  từ exon 2 – 19.  Kết luận: Phổ đột biến gen BTK trên bệnh nhân Việt Nam rất đa dạng, cần được khảo sát toàn bộ các vùng  của gen này cho trường hợp muốn xác định chẩn đoán XLA.  Từ khóa: Thiếu gammaglobulin máu liên kết nhiễm sắc thể X, đột biến gen BTK, giải trình tự chuỗi DNA.   ABSTRACT  BTK MUTATIONS IN PATIENTS WITH X‐LINKED AGAMMAGLOBULINEMIA  Hoang Anh Vu, Phan Thi Xinh, Nguyen Hoang Mai Anh, Hoang Le Phuc  * Y Hoc TP. Ho Chi Minh * Vol. 17 ‐ No 5 ‐ 2013: 195 ‐ 199  Introduction: X‐linked agammaglobulinemia is a primary immunodeficiency disease that clinically overlaps  with other immune disorders. Mutations in the gene for Bruton’s tyrosine kinase (BTK) are responsible for the  majority of agammaglobulinemia cases and the analysis of BTK is important for an accurate diagnosis and genetic  counseling.  Objective: This study aims to establish a testing procedure for identification of BTK mutations from blood‐ derived RNA as well as to describe BTK mutation spectrum in pediatric Vietnamese patients with XLA.  Patients and methods: We have analyzed BTK mutations in RNA extracted from blood of 22 patients with  XLA. All the coding region of BTK were amplified and sequenced.   Results: We  found BTK mutations  in 13 patients (59%),  including 8 deletions, 4 point mutations and 1  insertion. Mutations are distributed throughout the whole gene, from exon 2 to exon 19.   Conclusion: Spectrum  of  the BTK gene mutation  in Vietnamese patients  is  complex,  therefore  sequence  analysis of the whole gene are needed for an accurate diagnosis of XLA.  Keywords: X‐linked agammaglobulinemia, BTK gene mutation, DNA sequencing.  *Trung tâm Y sinh học Phân tử, Đại học Y Dược TPHCM  **Bộ môn Huyết học, Đại học Y Dược TPHCM  ***Bệnh viện Nhi Đồng I – TPHCM  Tác giả liên lạc: TS.BS. Hoàng Anh Vũ   ĐT: 0122‐2993537   Email: hoangvuxinh@yahoo.com Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Số 5 * 2013 Chuyên Đề Truyền Máu – Huyết Học  196 ĐẶT VẤN ĐỀ  Thiếu  gammaglobulin máu  liên  kết  nhiễm  sắc thể X (X‐linked agammaglobulinemia: XLA)  là một  tình  trạng  khiếm  khuyết miễn  dịch  di  truyền, gây ra do đột biến gen BTK dẫn đến mất  trưởng  thành  của  tế  bào  lymphô  B  tuần  hoàn  trong máu(12,14,16). Bệnh nhân XLA gần như không  có  tương  bào  nên  không  tạo  được  immunoglobulin, với một cơ địa rất dễ nhiễm vi  trùng và virus. Về mặt lâm sàng, chẩn đoán XLA  trùng lắp với các bệnh cảnh nhiễm trùng tái phát  trên cơ địa suy giảm miễn dịch khác.   Kể từ khi được mô tả lần đầu tiên bởi Bruton  vào năm 1952,  tỷ  lệ bệnh XLA mới  được  chẩn  đoán ngày càng tăng và có xu hướng phát hiện ở  tuổi  sớm  hơn.  Việc  phát  hiện  sớm  được  thực  hiện một phần nhờ phân tích đột biến gen BTK,  từ  đó  có  thể  chỉ  định  sớm  liệu  pháp  immunoglobulin  tĩnh mạch, giúp  cải  thiện  tiên  lượng cho bệnh nhân, giảm số đợt nhiễm trùng  và số lần nhập viện(4).  Chúng tôi tiến hành nghiên cứu này với mục  tiêu  xác  lập quy  trình  chẩn  đoán  đột biến gen  BTK từ RNA của bệnh nhân XLA đồng thời mô  tả  được  các  đột biến xuất hiện  trên bệnh nhân  Việt Nam.   ĐỐI TƯỢNG ‐ PHƯƠNG PHÁP NGHIÊN CỨU  Đối tượng nghiên cứu  Gồm  22 bệnh nhân nam  (từ  2  tháng  đến  5  tuổi) tại Bệnh viện Nhi Đồng I – Thành phố Hồ  Chí Minh  trong  thời gian  từ  tháng 10/2010 đến  tháng 11/2011. Bệnh nhân được chẩn đoán  lâm  sàng XLA dựa trên sự biến mất hoặc giảm nặng  tế  bào  B  trong máu  kèm  theo  bệnh  sử  nhiễm  trùng  tái phát hoặc nhiễm  trùng nặng, và/hoặc  giảm  đồng  loạt  các  thành  phần  globulin  IgG,  IgM  và  IgA  trong máu  (sau  khi  so  sánh  theo  tháng tuổi)(5).  Tách chiết RNA và tổng hợp cDNA  Từ mỗi bệnh nhi, chúng  tôi  thu nhận 4 mL  máu ngoại vi được chống đông trong EDTA có  bổ sung puromycin (200 μg/mL) và lắc nhẹ trong  4 giờ ở nhiệt độ phòng. Chúng tôi sử dụng RNA  RNeasy  mini  Kit  (Qiagen,  Mỹ)  để  tách  chiết  RNA từ máu ngoại biên, đo nồng độ bằng máy  quang phổ kế spectrophotometer. Từ 1 μg RNA  chúng  tôi  tiến  hành  tổng  hợp  DNA  bổ  sung  (complement DNA hay cDNA) với bộ hóa chất  SuperScript™  II  Reverse  Transcriptase  (Invitrogen, Mỹ). Chất  lượng cDNA được kiểm  tra bằng  cách khuếch  đại  đoạn  cDNA  của gen  beta‐actin dài 1180 bp.  Thực hiện PCR  Từ cDNA, vùng mã hóa của gen BTK được  khuếch đại bằng 2 cặp mồi. Đoạn đầu chứa các  exon  2  ‐  11  (1023  bp)  được  khuếch  đại  bằng  mồi  xuôi  BTK‐F1  (5’  –  GTGAACTCCAGAAAGAAGAAGCT – 3’) và  mồi  ngược  BTK‐R2  (5’  –  AATGACGTATCACCCCTTGAGG – 3’); đoạn  sau  chứa  các  exon  12  –  19  (1046  bp)  được  khuếch  đại  bằng  mồi  xuôi  BTK‐F3  (5’  –  GTTTGCTAAATCCACAGGGGAC  –  3’)  và  mồi  ngược  BTK‐R4  (5’  –  ACCAAGAAGCTTATTGGCGAGC  –  3’).  Trong mỗi tube PCR có tổng thể tích 25 μL, các  thành phần gồm có PCR buffer, dNTP (250 μM  cho mỗi loại), 2 loại mồi xuôi và ngược (0,5 μM  cho  mỗi  loại),  TaKaRa  TaqTM  HotStart  Polymerase  (Takara Bio, Nhật Bản) và  cDNA  (25 ng). Phản ứng khuếch đại được  thực hiện  trên  máy  GeneAmp®  PCR  system  9700  (Applied Biosystems, Mỹ), với giai  đoạn biến  tính ban đầu 980C trong 2 phút, theo sau bởi 40  chu  kỳ  luân  nhiệt  (980C  trong  10  giây,  600C  trong 15 giây, 720C  trong 70 giây) và kết  thúc  phản ứng ở 720C trong 5 phút. Sản phẩm PCR  được  phát  hiện  bằng  điện  di  trên  thạch  agarose 1,2%  có nhuộm ethidium bromide và  quan  sát  dưới  màn  soi  gel  Pringraph  (Atto,  Nhật Bản). Những trường hợp chỉ có một băng  đặc hiệu  thì sản phẩm PCR sẽ được  tinh sạch  trực  tiếp  bằng  QIAquick  Gel  Extraction  kit.  Trường hợp  có băng phụ xuất hiện,  các băng  chính và băng phụ sẽ được cắt riêng dưới màn  soi gel của Pringraph – Atto và được tinh sạch  riêng biệt.  Y Học TP. Hồ Chí Minh * Tập 17 * Số 5 * 2013  Nghiên cứu Y học Chuyên Đề Truyền Máu – Huyết Học  197 Thực hiện giải trình tự chuỗi DNA  Sản phẩm PCR  đã  được  tinh  sạch  sẽ  được  thực hiện phản ứng cycle sequencing với BigDye  V3.1  (Applied  Biosystems,  Mỹ),  theo  2  chiều  xuôi và ngược. Sản phẩm  sau  đó  được kết  tủa  bằng  ethanol,  hòa  tan  trong Hi‐Di  formamide,  biến tính ở 950C trong 2 phút trước khi làm lạnh  đột ngột. Trình tự DNA được đọc bằng máy ABI  3130 Genetic Analyzer,  với  POP‐7  polymer  và  capillary  50  cm  (Applied Biosystems, Mỹ). Kết  quả được phân  tích bằng phần mềm SeqScape,  dựa trên trình tự tham chiếu cDNA bình thường  của BTK với accession number NM_00061 trong  GenBank.  KẾT QUẢ VÀ BÀN LUẬN  Xây dựng kỹ  thuật giải  trình  tự RNA của  gen BTK  Gen BTK nằm trên nhiễm sắc thể giới tính X,  chiếm chiều dài hơn 37 kb, gồm 19 exon  trong  đó exon 2 – 19 mã hóa protein(13). Kỹ thuật phân  tích đột biến  trên RNA  tập  trung vào các exon,  để  phát  hiện  các  đột  biến  thuộc  vùng mã  hóa  protein của gen. Chúng tôi đã khuếch đại thành  công vùng mã hóa protein của gen BTK bằng 2  phản ứng PCR, với sản phẩm tương ứng là 1023  bp và 1046 bp, giúp đơn giản quá trình phân tích  đột  biến  gen  (Hình  1A).  Trước  khi  tách  chiết  RNA, mẫu máu đã được  trộn ủ với puromycin  nhằm ngăn chặn sự thoái hóa các RNA đột biến  trong tế bào(1).  Các  sản phẩm PCR  sau khi  được  tinh  sạch  đã  được  tiến hành giải  trình  tự  chuỗi DNA  để  xác định thay đổi trên exon của gen BTK. Toàn  bộ các kết quả giải trình tự chuỗi DNA đều cho  kết quả đặc hiệu với các vùng gen BTK đã được  khuếch đại.  Phát  hiện  đột  biến  gen  BTK  trên  bệnh  nhân XLA.  Trong thời gian từ tháng 10/ 2010 đến tháng  11/2011, chúng  tôi  tiến hành phân  tích đột biến  gen BTK cho 22 mẫu máu bệnh nhân XLA được  chẩn đoán  trong độ  tuổi  từ 2  tháng đến 5  tuổi.  Chúng  tôi  phát  hiện  13  bệnh  nhân  (59%)  có  mang đột biến của gen BTK, gồm 8 đột biến mất  đoạn, 4 đột biến điểm và 1 đột biến chèn đoạn  (Bảng 1).   Các  đột  biến mất  đoạn  gen  BTK  đã  được  nhiều tác giả mô tả trong bệnh XLA(7,9,15). Những  đột  biến  này  không  có  tính  khu  trú  vào một  vùng  nào  nhất  định,  nhưng  xảy  ra  trên  khắp  Nghiên cứu Y học  Y Học TP. Hồ Chí Minh * Tập 17 * Số 5 * 2013 Chuyên Đề Truyền Máu – Huyết Học  198 chiều dài của gen BTK,  từ exon 2  đến exon 19.  Đây  là những  đột biến  làm mất  đi nhiều vùng  chức  năng  quan  trọng  của  BTK  như  vùng  pleckstrin homology (PH) , vùng Src homology 3  (SH3),  SH2 và  SH1. Hình  1B minh họa  trường  hợp mất đoạn exon 7 – 15 trên một bệnh nhân 10  tháng tuổi. Các đột biến mất đoạn RNA của gen  BTK có thể là hậu quả của các đột biến điểm trên  intron trong genomic DNA, làm thay đổi những  điểm quan trọng cho hiện tượng nối ghép exon  diễn ra khi có sự phiên mã của gen(2,6). Chúng tôi  đang tiếp tục tiến hành thêm việc phân tích đột  biến  ở mức  genomic DNA  để  có  thể  xác  định  chính xác hơn  cơ  chế gây  đột biến  trên những  bệnh nhân có biểu hiện mất đoạn RNA.  Bảng 1: Các trường hợp bệnh nhân có đột biến gen BTK  STT Tuổi Giới tính Thay đổi nucleotide Thay đổi amino acid Vùng exon – intron bị đột biến 1 5 tuổi Nam c.1855C>A Pro619Thr Exon 8 2 2 tuổi Nam c.1059_1758del Mất đoạn Exon 12 – 18 3 10 tháng Nam c.574_1445del Mất đoạn Exon 7 – 15 4 2 tuổi Nam c.1093-1531_del Mất đoạn Exon 12 – 15 5 1 tuổi Nam Ins30 Chèn đoạn Intron 5 6 1 tuổi Nam c.1205 T>C Leu402Pro Exon 14 7 3 tuổi Nam c.91C>T Leu31Phe Exon 2 8 2 tuổi Nam c.393_1124del Mất đoạn Exon 6 – 13 9 1 tuổi Nam c.124_842del Mất đoạn Exon 2 – 10 10 2 tuổi Nam c.92_768del Mất đoạn Exon 2 – 8 11 4 tuổi Nam c.1921C>T Arg641Cys Exon 19 12 6 tháng Nam c.110_563del Mất đoạn Exon 2 – 7 13 10 tháng Nam c.1066_1703del Mất đoạn Exon 12 – 17 Trong  số  4  đột  biến  điểm  được  chúng  tôi  phát hiện, các đột biến Leu402Pro, Pro619Thr và  Arg641Cys đã được báo cáo trong bệnh XLA(8,9,11)  và  được  tổng  hợp  trong  Resource  of  Asian  Primary  Immunodeficiency Diseases. Tại codon  31,  đột  biến  thay  thế  leucine  bằng  proline  (Leu31Pro)  cũng  đã  từng  được  báo  cáo  trước  đây(3),  nhưng  đột  biến  thay  thế  leucine  bằng  phenylalanine (Leu31Phe) trong nghiên cứu này  là  một  đột  biến  mới  được  phát  hiện.  Vị  trí  leucine 31 thuộc vùng PH của BTK, được biết có  khả  năng  tương  tác  với  protein  phosphatidylinositol(3,4,5)‐triphosphate  (PIP3)  trong  quá  trình  hoạt  hóa  BTK(10).  Đột  biến  Leu31Phe có thể đã ảnh hưởng lên sự tương tác  với PIP3 và làm giảm hoạt động chức năng của  BTK trong tế bào B của bệnh nhân XLA.  Đột biến chèn 30 nucleotide của intron 5 vào  giữa exon 5 – 6 tạo nên một protein mới gồm 669  amino acid so với protein BTK chỉ có 659 amino  acid. Do hiện  tượng chèn đoạn  làm  lệch khung  đọc nên protein mới chỉ còn  lại 130 amino acid  đầu  tiên  thuộc  vùng  chức  năng  PH  giống  với  protein BTK,  trong khi  đó  các vùng  chức năng  SH 1 – 3 đã bị thay thế bằng chuỗi polypeptide  lạ. Sự biến mất các vùng SH 1 – 3 có thể đã ảnh  hưởng  nghiêm  trọng  đến  chức  năng  của  BTK  trong tế bào B dẫn đến biểu hiện bệnh.  Chúng  tôi  không  phát  hiện  được  đột  biến  gen BTK trên 9 bệnh nhân trong nghiên cứu này.  Một trong những hạn chế khi phân tích đột biến  ở mức RNA  là không khảo  sát vùng promoter  của gen BTK, có  thể đã bỏ sót các đột biến  làm  giảm khả năng phiên mã và ảnh hưởng trên sự  giải mã  protein  BTK.  Các  bệnh  nhân  này  cần  được  giải  trình  tự  genomic DNA,  bao  gồm  cả  vùng promoter để có thể phát hiện thêm các đột  biến giúp xác định chẩn đoán bệnh XLA.   KẾT LUẬN  Sử dụng kỹ thuật phân tích đột biến ở mức  RNA,  chúng  tôi  đã  phát  hiện  59%  bệnh  nhân  XLA có đột biến gen BTK. Vì các đột biến xuất  hiện trên toàn bộ các vùng chức năng quan trọng  của gen này, nên cần phân  tích  tất cả các exon  khi muốn xác định đột biến để hỗ trợ chẩn đoán  chính xác bệnh XLA.  Y Học TP. Hồ Chí Minh * Tập 17 * Số 5 * 2013  Nghiên cứu Y học Chuyên Đề Truyền Máu – Huyết Học  199 TÀI LIỆU THAM KHẢO  1. Andreutti‐Zaugg C, Scott RJ, Iggo R. Inhibition of nonsense‐ mediated messenger RNA decay in clinical samples facilitates  detection of human MSH2 mutations with an  in vivo fusion  protein  assay  and  conventional  techniques.  Cancer  Res  1997;57(15):3288‐93.  2. Brooimans RA, van den Berg AJ, Rijkers GT, Sanders LA, van  Amstel JK, Tilanus MG, Grubben MJ, Zegers BJ. Identification  of novel Brutonʹs  tyrosine kinase mutations  in  10 unrelated  subjects with X linked agammaglobulinaemia. J of Med Genet  1997;34:484‐488.  3. Conley  ME,  Broides  A,  Hernandez‐Trujillo  V,  Howard  V,  Kanegane H, Miyawaki T, Shurtleff SA. Genetic analysis of  patients with defects  in  early B‐cell development.  Immunol  Rev 2005;203:216‐217.  4. Conley  ME,  Howard  V.  Clinical  findings  leading  to  the  diagnosis  of  X‐linked  agammaglobulinemia.  J  Pediatr  2002;141:566‐71.  5. Conley ME, Notarangelo LD, Etzioni A. Diagnostic criteria for  primary  immunodeficiencies.  Representing  PAGID  (Pan‐ American Group for Immunodeficiency) and ESID (European  Society  for  Immunodeficiencies).  Clin  Immunol  1999;93(3):190‐7.  6. Fiorini M, Franceschini R, Soresina A, Schumacher RF, Ugazio  AG, Rossi P, Plebani A, Notarangelo LD. BTK: 22 novel and  25  recurrent mutations  in  European  patients with  X‐linked  agammaglobulinemia. Hum Mutat. 2004 Mar;23(3):286.  7. Hashimoto S, Tsukada S, Matsushita M, Miyawaki T, Niida Y,  Yachie A, Kobayashi S, Iwata T, Hayakawa H, Matsuoka H,  Tsuge  I,  Yamadori  T,  Kunikata  T,  Arai  S,  Yoshizaki  K,  Taniguchi N, Kishimoto T. Identification of Brutonʹs tyrosine  kinase  (Btk)  gene  mutations  and  characterization  of  the  derived  proteins  in  35  X‐linked  agammaglobulinemia  families: a nationwide study of Btk deficiency in Japan. Blood  1996;88(2):561‐573.  8. Holinski‐Feder E, Weiss M, Brandau O,  Jedele KB, Nore B,  Bäckesjö  CM,  Vihinen  M,  Hubbard  SR,  Belohradsky  BH,  Smith CI, Meindl A. Mutation screening of the BTK gene in 56  families  with  X‐linked  agammaglobulinemia  (XLA):  47  unique  mutations  without  correlation  to  clinical  course.  Pediatrics 1998;101(2):276‐284.  9. Kanegane H, Futatani T, Wang Y, Nomura K, Shinozaki K,  Matsukura H, Kubota T, Tsukada S, Miyawaki T. Clinical and  mutational  characteristics  of  X‐linked  agammaglobulinemia  and  its  carrier  identified  by  flow  cytometric  assessment  combined  with  genetic  analysis.  J  Allergy  Clin  Immunol  2001;108:1012‐20.  10. Lindvall JM, Blomberg KE, Väliaho J, Vargas L, Heinonen JE,  Berglöf  A,  Mohamed  AJ,  Nore  BF,  Vihinen  M,  Smith  CI.  Brutonʹs tyrosine kinase: cell biology, sequence conservation,  mutation  spectrum,  siRNA  modifications,  and  expression  profiling. Immunological Reviews 2005;203:200‐215.  11. López‐Granados  E,  Pérez  de  Diego  R,  Ferreira  Cerdán  A,  Fontán  Casariego  G,  García  Rodríguez  MC.  A  genotype‐ phenotype correlation study in a group of 54 patients with X‐ linked  agammaglobulinemia.  J  Allergy  Clin  Immunol  2005;116(3):690‐7.  12. Ochs HD, Smith CI. X‐linked agammaglobulinemia. A clinical  and molecular analysis. Medicine 1996;75:287‐299.  13. Rohrer J, Parolini O, Belmont JW, Conley ME, Parolino O. The  genomic  structure  of  human BTK,  the defective  gene  in X‐ linked  agammaglobulinemia.  Immunogenetics  1994;  40:319– 324.  14. Sideras P, Smith CI. Molecular and cellular aspects of X‐linked  agammaglobulinemia. Adv Immunol 1995;59:135‐223.  15. Speletas  M,  Kanariou  M,  Kanakoudi‐Tsakalidou  F,  Papadopoulou‐Alataki  E,  Arvanitidis  K,  Pardali  E,  Constantopoulos A, Kartalis G, Vihinen M, Sideras P, Ritis K.  Analysis  of  Btk  mutations  in  patients  with  X‐linked  agammaglobulinaemia  (XLA)  and  determination  of  carrier  status  in normal  female relatives: a nationwide study of Btk  deficiency in Greece. Scand. J. Immunol 2001;54: 321‐327.  16. Vetrie  D,  Vorechovský  I,  Sideras  P,  Holland  J,  Davies  A,  Flinter F, Hammarström L, Kinnon C, Levinsky R, Bobrow M.  The  gene  involved  in  X‐linked  agammaglobulinaemia  is  a  member of the src family of protein‐tyrosine kinases. Nature  1993;361:226–233.  17. Winkelstein  JA,  Marino  MC,  Lederman  HM,  Jones  SM,  Sullivan K, Burks AW, Conley ME, Cunningham‐Rundles C,  Ochs HD. X‐linked agammaglobulinemia: report on a United  States  registry  of  201  patients.  Medicine  (Baltimore)  2006;85:193‐202.  Ngày nhận bài báo:      15 tháng 8 năm 2013  Ngày phản biện:      04 tháng 9 năm 2013  Ngày bài báo được đăng:   22  tháng  10  năm  2013