Phát hiện đột biến gen EGFR trên bệnh nhân ung thư phổi không tế bào nhỏ có đáp ứng với erlotinib

Giới thiệu: Đột biến gen EGFR gây nên ung thư phổi không tế bào nhỏ (UTPKTBN). Mặc dù erlotinib đã được chỉ định cho điều trị ung thư này tại Việt Nam, cơ sở phân tử cho chỉ định điều trị vẫn chưa được khảo sát. Đối tượng và phương pháp nghiên cứu: Bệnh nhân UTPKTBN có đáp ứng với erlotinib của Khoa C4 Bệnh viện Phạm Ngọc Thạch được khảo sát đột biến gen EGFR tại 4 exon (18 – 21). Sau khi khuếch đại thành công bằng PCR từ bệnh phẩm là mô vùi nến, đột biến của EGFR được xác định bằng kỹ thuật giải trình tự chuỗi DNA. Kết quả: 2 đột biến của exon 19 và 1 đột biến của exon 21 được phát hiện ở 3 bệnh nhân. Các đột biến này đã được báo cáo nhạy với erlotinib. Kết luận: Chẩn đoán đột biến EGFR bằng giải trình tự chuỗi DNA có thể giúp ích cho lựa chọn bệnh nhân UTPKTBN trong chỉ định điều trị thuốc nhắm trúng đích phân tử.

pdf5 trang | Chia sẻ: thanhuyen291 | Ngày: 14/06/2022 | Lượt xem: 246 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phát hiện đột biến gen EGFR trên bệnh nhân ung thư phổi không tế bào nhỏ có đáp ứng với erlotinib, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 150 PHÁT HIỆN ĐỘT BIẾN GEN EGFR TRÊN BỆNH NHÂN UNG THƯ PHỔI KHÔNG TẾ BÀO NHỎ CÓ ĐÁP ỨNG VỚI ERLOTINIB Hoàng Anh Vũ*, Nguyễn Thiện Nhân**, Phan Thị Xinh***, Nguyễn Sơn Lam**, Trần Đình Thanh** TÓM TẮT Giới thiệu: Đột biến gen EGFR gây nên ung thư phổi không tế bào nhỏ (UTPKTBN). Mặc dù erlotinib đã được chỉ định cho điều trị ung thư này tại Việt Nam, cơ sở phân tử cho chỉ định điều trị vẫn chưa được khảo sát. Đối tượng và phương pháp nghiên cứu: Bệnh nhân UTPKTBN có đáp ứng với erlotinib của Khoa C4 Bệnh viện Phạm Ngọc Thạch được khảo sát đột biến gen EGFR tại 4 exon (18 – 21). Sau khi khuếch đại thành công bằng PCR từ bệnh phẩm là mô vùi nến, đột biến của EGFR được xác định bằng kỹ thuật giải trình tự chuỗi DNA. Kết quả: 2 đột biến của exon 19 và 1 đột biến của exon 21 được phát hiện ở 3 bệnh nhân. Các đột biến này đã được báo cáo nhạy với erlotinib. Kết luận: Chẩn đoán đột biến EGFR bằng giải trình tự chuỗi DNA có thể giúp ích cho lựa chọn bệnh nhân UTPKTBN trong chỉ định điều trị thuốc nhắm trúng đích phân tử. Từ khóa: Đột biến gen EGFR, ung thư phổi không tế bào nhỏ, erlotinib ABSTRACT EGFR GENE MUTATION IN NON-SMALL CELL LUNG CANCERS RESPONSED WITH ERLOTINIB Hoang Anh Vu, Nguyen Thien Nhan, Phan Thi Xinh, Nguyen Son Lam, Tran Dinh Thanh * Y Hoc TP. Ho Chi Minh * Vol. 15 - Supplement of No 2 - 2011: 150 - 154 Background: EGFR mutations lead to non-small cell lung cancer (NSCLC). Although erlotinib response was observed in Vietnamese patients, the molecular mechanism underlying sensitivity to erlotinib was not investigated. Material and method: Tumors from patients with NSCLC who had a response to erlotinib were searched for mutation in EGFR exons 18 – 21. PCR was used to amplify 4 exons from DNA of paraffin-embedded tissue samples, followed by direct DNA sequencing. Results: Two mutations in exon 19 and 1 mutation in exon 21 were detected in 3 patients. These mutations were known to be sensitive to erlotinib. Conclusion: Detection of EGFR mutation is now available for selecting NSCLC patients benefit from molecularly targeted therapy. Key words: EGFR mutations, non-small cell lung cancer, erlotinib. ĐẶT VẤN ĐỀ Ung thư phổi nguyên phát gây tử vong hàng đầu trong số những loại ung thư thường gặp(1). Tiên lượng rất xấu của ung thư phổi là do chẩn đoán thường chỉ thực hiện được trong giai đoạn trễ, can thiệp phẫu thuật không còn khả thi hoặc hiệu quả rất hạn chế do tế bào ung thư đã xâm lấn hay di căn xa. Về mặt chẩn đoán, ung thư phổi nguyên phát được chia thành nhóm ung thư phổi không tế bào nhỏ *Bộ môn Mô – Phôi, Đại học Y Dược TP.HCM **Khoa C4, Bệnh viện Phạm Ngọc Thạch ***Bộ môn Huyết học, Đại học Y Dược TP.HCM Tác giả liên lạc: TS. Hoàng Anh Vũ ĐT: 01222993537 Email: hoangvuxinh@yahoo.com Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 151 (UTPKTBN) và ung thư phổi tế bào nhỏ. UTPKTBN chiếm khoảng 80%, do đột biến của gen EGFR gây ra(5). Erlotinib (biệt dược Tarceva của Roche) được chấp nhận là chỉ định thay thế (second-line therapy) cho UTPKTBN ở giai đoạn tiến xa đã thất bại với hóa trị liệu chuẩn. Trong trường hợp này thuốc giúp kéo dài thời gian sống thêm trung bình từ 4,7 tháng lên 6,7 tháng(11). Hiện nay erlotinib đã được dùng trong điều trị ung thư phổi trên 80 quốc gia. Các kết quả nghiên cứu nhằm tìm ra những dấu ấn sinh học cho đáp ứng với thuốc ức chế đặc hiệu EGFR cho thấy tình trạng đột biến gen EGFR chính là yếu tố tiên đoán chính xác nhất, trong khi đó hóa mô miễn dịch để đánh giá biểu hiện protein lại không cho thông tin có ý nghĩa nào cho tiên đoán đáp ứng điều trị(6,8,16). Tại Việt Nam, đã có những báo cáo về đáp ứng lâm sàng của bệnh nhân UTPKTBN được điều trị bằng erlotinib(7,17). Chúng tôi thực hiện nghiên cứu này nhằm làm rõ hơn cơ chế phân tử của những đáp ứng điều trị quan sát được trên bệnh nhân Việt Nam. ĐỐI TƯỢNG - PHƯƠNG PHÁP NGHIÊN CỨU Đối tượng nghiên cứu 4 bệnh nhân UTPKTBN thuộc khoa C4 – Bệnh viện Phạm Ngọc Thạch, có đáp ứng với erlotinib, được chọn để xác định tình trạng đột biến của gen EGFR. Tiêu chuẩn đáp ứng với erlotinib bao gồm: cải thiện các triệu chứng về hô hấp trên lâm sàng và kích thước u, nốt di căn phổi, tình trạng tái lập dịch màng phổi dựa trên X quang phổi thẳng, CT scan ngực. Các bệnh nhân này được điều trị trong khoảng thời gian từ tháng 10/2008 tới tháng 10/2010. Tách chiết genomic DNA Bệnh phẩm là mô vùi nến đã dùng để chẩn đoán giải phẫu bệnh. Trong 4 mẫu nghiên cứu, 3 từ bệnh phẩm phẫu thuật, 1 từ sinh thiết. Trường hợp là bệnh phẩm phẫu thuật, vùng mô ung thư được đánh dấu trên lam giải phẫu bệnh để thu vào tube ly tâm 1,5 mL nhằm tăng khả năng chẩn đoán được đột biến. Bệnh phẩm sinh thiết quá nhỏ không thể đánh dấu phân biệt vùng ung thư và mô lành nên được thu toàn bộ vào tube ly tâm. Xylene (Merk, Đức) được thêm vào tube ly tâm 2 lần để khử nến, sau đó được rửa lại bằng ethanol tuyệt đối và để khô trước khi ủ với proteinase K (Invitrogen, Mỹ) ở 480C trong 16 giờ. Tinh sạch sản phẩm DNA sau khi ủ proteinase K được thực hiện bằng phenol – chloroform (Invitrogen, Mỹ). Cuối cùng, kết tủa DNA bằng ethanol tuyệt đối trong muối NH4OAC và định nồng độ DNA bằng spectrophotometer. Khuếch đại các exon bằng PCR Các đoạn mồi (Bảng 1) được thiết kế bằng phần mềm Oligo 4.1 dựa trên trình tự chuẩn của EGFR mang accession number NG_007726 trong GenBank. Trong mỗi tube PCR có tổng thể tích 50 µL, các thành phần gồm có PCR buffer, dNTP (250 µM cho mỗi loại), 2 loại mồi xuôi và ngược (0,5 µM cho mỗi loại), 1,25 unit TaKaRa TaqTM HotStart Polymerase (Takara, Nhật Bản) và 20 ng genomic DNA. Chu kỳ luân nhiệt được thực hiện trên máy GeneAmp® PCR system 9700 (Applied Biosystems, Mỹ) bao gồm giai đoạn biến tính ban đầu ở 980C trong 2 phút, theo sau bằng 40 chu kỳ gồm biến tính ở 980C trong 10 giây, gắn mồi ở 600C trong 15 giây, tổng hợp chuỗi DNA ở 720C trong 1 phút và kết thúc bằng giai đoạn kéo dài sản phẩm ở 720C trong 5 phút. Sản phẩm PCR được phát hiện bằng điện di trên thạch agarose 2% có nhuộm ethidium bromide và quan sát dưới màn soi gel Pringraph (Atto, Nhật Bản). Sản phẩm PCR được tinh sạch bằng QIAquick Gel Extraction kit (Qiagen, Mỹ) và được kiểm tra lại bằng điện di trên thạch agarose 2%. Bảng 1: Các đoạn mồi dùng trong nghiên cứu Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 152 Tên mồi Trình tự (5’--- 3’) Exon được khuếch đại Sản phẩm PCR (bp) EGFR.18F CATGGTGAGGGCTGAGGTGA EGFR.18R CTTGCAAGGACTCTGGGCT 18 252 EGFR.19F GCATGTGGCACCATCTCACA EGFR.19R GAGAAAAGGTGGGCCTGAGG 19 217 EGFR.20F ACCTGGAAGGGGTCCATGTG EGFR.20R TGCTATCCCAGGAGCGCAGA 20 341 EGFR.21F TCACAGCAGGGTCTTCTCTGTTT EGFR.21R ATGCTGGCTGACCTAAAGCC 21 212 Thực hiện giải trình tự chuỗi DNA Sản phẩm PCR đã được tinh sạch sẽ được thực hiện phản ứng cycle sequencing với BigDye V3.1 từ Applied Biosystems, theo 2 chiều xuôi và ngược cho mỗi exon. Sản phẩm sau đó được kết tủa bằng ethanol, hòa tan trong Hi-Di formamide, biến tính ở 950C trong 2 phút trước khi làm lạnh đột ngột. Trình tự DNA được đọc bằng máy ABI 3130 Genetic Analyzer, với POP-7 polymer và capillary 50 cm (Applied Biosystems, Mỹ). Kết quả được phân tích bằng phần mềm SeqScape, so sánh với trình tự tham chiếu của EGFR mang accession number NG_007726 để chẩn đoán tình trạng đột biến của các exon. Quy trình chẩn đoán đột biến gen được thực hiện tại Đại học Y Dược TP. Hồ Chí Minh. KẾT QUẢ VÀ BÀN LUẬN Hầu hết đột biến EGFR trong UTPKTBN nằm trong các exon 18 – 21(9). Vì các đột biến rất đa dạng, bao gồm đột biến điểm, đột biến mất đoạn và đột biến thêm đoạn nên giải trình tự chuỗi DNA được coi là kỹ thuật phù hợp nhất để khảo sát đột biến. Các kỹ thuật khác chỉ khảo sát các đột biến thường được báo cáo sẽ bỏ sót những đột biến mới, nhất là trên những quần thể mới được nghiên cứu lần đầu như bệnh nhân Việt Nam. Để có thể giải trình tự chuỗi DNA, bước quyết định là phải khuếch đại được các exon muốn tìm đột biến từ mô vùi nến. Hình 1A cho thấy các exon đã được khuếch đại một cách đặc hiệu bằng các đoạn mồi do chúng tôi thiết kế. Trong điều kiện PCR của chúng tôi, nhiệt độ bắt cặp của cả 4 cặp mồi là 600C, giúp cho việc khuếch đại cùng lúc 4 exon bằng một chương trình luân nhiệt rất thuận lợi. Kết quả giải trình tự sau đó phát hiện 3 bệnh nhân có mang đột biến của EGFR (Hình 1B). Đột biến L858R, do thay thế thymidine bằng guanine tại codon 858 của exon 21, là một trong những đột biến thường gặp nhất trong UTPKTBN(4). Đột biến Del_L747-S752 do mất đi 18 nucleic acid của exon 19, là đột biến hiếm gặp (chiếm khoảng 0,79% trong tổng số các trường hợp đột biến được tổng kết trong EGFR mutation database). Riêng đột biến tại codon 702 chỉ mới được báo cáo 3 trường hợp trong UTPKTBN. Cả 3 đột biến này đều nằm trong vùng đột biến nhạy với erlotinib. Kết quả của chúng tôi chứng tỏ kỹ thuật giải trình tự DNA giúp phát hiện được cả đột biến thường được báo cáo cũng như những đột biến hiếm gặp. Đây được coi là tiêu chuẩn vàng cho chẩn đoán đột biến gen EGFR trong các nghiên cứu lâm sàng(14,15). Cần lưu ý rằng kỹ thuật này chỉ có khả năng phát hiện đột biến nếu số tế bào có mang đột biến (tế bào ung thư) chiếm từ 30% trong tổng số tế bào thu được trong tube ly tâm(6). Vì thế, việc đánh dấu vùng tế bào ung thư để phân biệt với mô bình thường xung quanh trên lam giải phẫu bệnh trước khi thu tế bào là bước vô cùng quan trọng, tránh khả năng bỏ sót đột biến. Chúng tôi không phát hiện đột biến trên 1 bệnh nhân có bệnh phẩm là mô sinh thiết, có thể do tỷ lệ tế bào ung thư quá ít vì không tách được mô lành ra khỏi mô ung thư. Trong trường hợp này, các kỹ thuật có độ nhạy cao hơn nên được triển khai thêm để bổ sung cho giải trình tự chuỗi DNA(3,6). Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 153 Hình 1: Đột biến EGFR. (A) khuếch đại đặc hiện 4 exon 18 – 21 bằng PCR. (B) các đột biến được phát hiện bằng giải trình tự chuỗi DNA. Ngoài erlotinb, gefitinib (biệt dược Iressa của Astrazeneca) cũng là thuốc ức chế đặc hiệu EGFR. Nếu được chỉ định rộng rãi, thuốc này không cải thiện thời gian sống thêm trên bệnh nhân người da trắng, vì vậy không được chỉ định tại Mỹ và châu Âu(12). Tuy nhiên, trên bệnh nhân châu Á, Iressa tỏ ra rất hiệu quả, đặc biệt nếu bệnh nhân có mang đột biến của EGFR. Một nghiên cứu trên bệnh nhân Nhật Bản cho thấy tỷ lệ sống thêm 1 năm là 79%(12). Nhóm tác giả của Mỹ công bố kết quả rất khả quan về hiệu quả của gefitinib khi được chỉ định ưu tiên cho bệnh nhân UTPKTBN có mang đột biến của EGFR, với tỷ lệ sống thêm 1 năm là 73% và thời gian sống thêm trung vị là 17,5 tháng(10). Ngay cả những trường hợp đã có di căn não, erlotinib và gefitinib cũng tỏ ra có hiệu quả trên bệnh nhân có mang đột biến EGFR(2). Thành công trong chẩn đoán đột biến EGFR bằng kỹ thuật giải trình tự chuỗi DNA của chúng tôi có thể giúp ích cho điều trị bệnh nhân bằng erlotinib hay gefitinib. Hiện nay kỹ thuật này cũng đang được ứng dụng tại Đại học Y Dược TP.HCM để khảo sát đột biến EGFR trên bệnh nhân UTPKTBN nhằm mô tả được tần suất cũng như phổ đột biến gen này trên bệnh nhân Việt Nam. KẾT LUẬN Kỹ thuật giải trình tự chuỗi DNA đã được ứng dụng thành công để phát hiện đột biến EGFR trong UTPKTBN trên bệnh nhân Việt Nam, giúp lựa chọn điều trị nhắm trúng đích phân tử bằng erlotinib và gefitinib. TÀI LIỆU THAM KHẢO 1. Dubey S, Powell CA (2007). Update in lung cancer 2006. Am J Respir Crit Care Med;175(9):868-74. 2. Inoue A, Suzuki T, Fukuhara T, Maemondo M, Kimura Y, Morikawa N, et al (2006). Prospective phase II study of gefitinib for chemotherapy-naive patients with advanced non-small-cell lung cancer with epidermal growth factor receptor gene mutations. J Clin Oncol;24(21):3340-6. 3. Janne PA, Borras AM, Kuang Y, Rogers AM, Joshi VA, Liyanage H, et al (2006). A rapid and sensitive enzymatic method for epidermal growth factor receptor mutation screening. Clin Cancer Res;12:751-8. 4. Johnson BE, Janne PA (2005). Epidermal growth factor receptor mutations in patients with non-small cell lung cancer. Cancer Res;65(17):7525-9. 5. Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, Brannigan BW, et al (2004). Activating mutations in the Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 154 epidermal growth factor receptor underlying responsiveness of non- small-cell lung cancer to gefitinib. N Engl J Med;350(21):2129-39. 6. Marchetti A, Martella C, Felicioni L, Barassi F, Salvatore S, Chella A, et al (2005). EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol;23(4):857-65. 7. Nguyễn Thiện Nhân, Trần Đình Thanh, Nguyễn Sơn Lam, Nguyễn Trần Phùng (2010). Báo cáo một trường hợp ung thư phế quản – phổi xâm lấn gây chít hẹp khí quản, đáp ứng hoàn toàn sau 10 ngày điều trị bằng erlotinib. Y học TP. Hồ Chí Minh;14(4):379 – 85. 8. Parra HS, Cavina R, Latteri F, Zucali PA, Campagnoli E, Morenghi E, et al (2004). Analysis of epidermal growth factor receptor expression as a predictive factor for response to gefitinib ('Iressa', ZD1839) in non-small-cell lung cancer. Br J Cancer;91(2):208-12. 9. Rosell R, Moran T, Queralt C, Porta R, Cardenal F, Camps C, et al (2009). Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med;361(10):958-67. 10. Sequist LV, Martins RG, Spigel D, Grunberg SM, Spira A, Janne PA, et al (2008). First-line gefitinib in patients with advanced non- small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol;26(15):2442-9. 11. Shepherd FA, Rodrigues Pereira J, Ciuleanu T, Tan EH, Hirsh V, Thongprasert S, et al (2005). Erlotinib in previously treated non- small-cell lung cancer. N Engl J Med;353(2):123-32. 12. Stinchcombe TE, Socinski MA (2008). Considerations for second- line therapy of non-small cell lung cancer. Oncologist;13:28-36. 13. Tamura K, Okamoto I, Kashii T, Negoro S, Hirashima T, Kudoh S, et al (2008). Multicentre prospective phase II trial of gefitinib for advanced non-small cell lung cancer with epidermal growth factor receptor mutations: results of the West Japan Thoracic Oncology Group trial (WJTOG0403). Br J Cancer;98(5):907-14. 14. Toyooka S, Takano T, Kosaka T, Hotta K, Matsuo K, Ichihara S, et al (2008). Epidermal growth factor receptor mutation, but not sex and smoking, is independently associated with favorable prognosis of gefitinib-treated patients with lung adenocarcinoma. Cancer Sci;99(2):303-8. 15. Tsao MS, Sakurada A, Cutz JC, Zhu CQ, Kamel-Reid S, Squire J, et al (2005). Erlotinib in lung cancer - molecular and clinical predictors of outcome. N Engl J Med;353(2):133-44. 16. Uramoto H, Sugio K, Oyama T, Ono K, Sugaya M, Yoshimatsu T, et al (2006). Epidermal growth factor receptor mutations are associated with gefitinib sensitivity in non-small cell lung cancer in Japanese. Lung Cancer;51(1):71-7. 17. Vũ Văn Vũ, Đặng Thanh Hồng và cs (2010). Điều trị ung thư phổi không tế bào nhỏ tiến xa bằng erlotinib – những nhận định ban đầu nhân 10 trường hợp tại Bệnh biện Ung bướu TPHCM 2008 – 2010. Y học TP. Hồ Chí Minh;14(4):408 – 413.
Tài liệu liên quan