Phát hiện đột biến gen P53 ở bệnh nhân ung thư vú qua nhuộm hoá mô miễn dịch và giải trình tự gen

Mở đầu: Ung thư vú đứng hàng thứ ba trong các loại ung thư trên thế giới. Tỉ lệ mắc bệnh và tỉ lệ tử vong thay đổi tùy từng quốc gia. Ung thư vú liên quan đến nhiều loại biến đổi di truyền khác nhau ở tế bào sinh dưỡng, như đột biến ở gen sinh khối u và gen ức chế khối u. Ngoài ra, yếu tố môi trường cũng tác động lên bệnh căn của ung thư vú. Ngày nay, trong ung thư vú, các đột biến gen được nghiên cứu nhiều, nhất là ở gen ức chế khối u p53 với tỉ lệ gặp khoảng 30%. Một số nghiên cứu đánh giá vai trò của đột biến gen p53 trong tiên lượng bệnh ung thư vú đã gây nhiều tranh cãi. Nhiều nghiên cứu cũng đã cố gắng nhận diện giai đoạn phát sinh ung thư vú mà tại đó đột biến p53 ở các tế bào sinh dưỡng xảy ra. Phối hợp phương pháp nhuộm hóa mô miễn dịch protein P53 và xác định đột biến gen p53 bằng phương pháp giải trình tự có thể giúp đánh giá được được mối tương quan giữa đột biến gen p53 với kiểu biểu hiện của protein P53, tiên lượng sống cũng như đưa ra phương pháp trị liệu thích hợp cho bệnh nhân. Mục tiêu: Xác định tỉ lệ đột biến gen p53 (exon 5-8) ở bệnh nhân bị carcinôm tuyến vú bằng phương pháp giải trình tự gen và sự biểu hiện protein p53 bằng phương pháp hóa mô miễn dịch (IHC). Phương pháp: Nghiên cứu cắt ngang trên 100 bệnh nhân được chẩn đoán carcinôm tuyến vú tại Bộ Môn Giải Phẫu Bệnh Đại Học Y Dược trong thời gian từ tháng 06/2008 đến tháng 6/2010. Sử dụng kỹ thuật hóa mô miễn dịch để xem xét sự tích tụ protein p53 trong nhân tế bào và kỹ thuật giải trình tự gen để xác định tình trạng đột biến gen p53. Phân tích mối tương quan giữa tình trạng đột biến gen p53 và tình trạng tích tụ protein p53 trong nhân tế bào.

pdf9 trang | Chia sẻ: thuyduongbt11 | Ngày: 13/06/2022 | Lượt xem: 205 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phát hiện đột biến gen P53 ở bệnh nhân ung thư vú qua nhuộm hoá mô miễn dịch và giải trình tự gen, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 99 PHÁT HIỆN ĐỘT BIẾN GEN P53 Ở BỆNH NHÂN UNG THƯ VÚ QUA NHUỘM HOÁ MÔ MIỄN DỊCH VÀ GIẢI TRÌNH TỰ GEN Đỗ Thị Thanh Thủy*, Hoàng Anh Vũ*, Hứa Thị Ngọc Hà*, Nguyễn Sào Trung* TÓM TẮT Mở đầu: Ung thư vú đứng hàng thứ ba trong các loại ung thư trên thế giới. Tỉ lệ mắc bệnh và tỉ lệ tử vong thay đổi tùy từng quốc gia. Ung thư vú liên quan đến nhiều loại biến đổi di truyền khác nhau ở tế bào sinh dưỡng, như đột biến ở gen sinh khối u và gen ức chế khối u. Ngoài ra, yếu tố môi trường cũng tác động lên bệnh căn của ung thư vú. Ngày nay, trong ung thư vú, các đột biến gen được nghiên cứu nhiều, nhất là ở gen ức chế khối u p53 với tỉ lệ gặp khoảng 30%. Một số nghiên cứu đánh giá vai trò của đột biến gen p53 trong tiên lượng bệnh ung thư vú đã gây nhiều tranh cãi. Nhiều nghiên cứu cũng đã cố gắng nhận diện giai đoạn phát sinh ung thư vú mà tại đó đột biến p53 ở các tế bào sinh dưỡng xảy ra. Phối hợp phương pháp nhuộm hóa mô miễn dịch protein P53 và xác định đột biến gen p53 bằng phương pháp giải trình tự có thể giúp đánh giá được được mối tương quan giữa đột biến gen p53 với kiểu biểu hiện của protein P53, tiên lượng sống cũng như đưa ra phương pháp trị liệu thích hợp cho bệnh nhân. Mục tiêu: Xác định tỉ lệ đột biến gen p53 (exon 5-8) ở bệnh nhân bị carcinôm tuyến vú bằng phương pháp giải trình tự gen và sự biểu hiện protein p53 bằng phương pháp hóa mô miễn dịch (IHC). Phương pháp: Nghiên cứu cắt ngang trên 100 bệnh nhân được chẩn đoán carcinôm tuyến vú tại Bộ Môn Giải Phẫu Bệnh Đại Học Y Dược trong thời gian từ tháng 06/2008 đến tháng 6/2010. Sử dụng kỹ thuật hóa mô miễn dịch để xem xét sự tích tụ protein p53 trong nhân tế bào và kỹ thuật giải trình tự gen để xác định tình trạng đột biến gen p53. Phân tích mối tương quan giữa tình trạng đột biến gen p53 và tình trạng tích tụ protein p53 trong nhân tế bào. Kết quả: Trong các mẫu mô của bệnh nhân được chẩn đoán carcinoma tuyến vú, tỷ lệ biểu hiện tích tụ protein P53 trong nhân tế bào là 57%. Gen p53 (exon 5 - exon 8) được phân tích bằng phương pháp giải trình tự, tỉ lệ đột biến là 28%, đột biến xảy ở exon 5 chiếm tỉ lệ cao nhất (69,4%). Đột biến nhầm nghĩa chiếm tỉ lệ 91,6%. Đột biến xảy ra chủ yếu ở vị trí thứ 1 và thứ 2 (100%) của mã di truyền. 33% đột biến xảy ra trong vùng trình tự bảo tồn của gen và 25% đột biến xảy ra trong vùng CpG. Đột biến xảy ra ở codon 175 chiếm 5,6%. Đột biến Tyr163Cys chiếm 14%. Đột biến xảy ra cao nhất trong vùng L2/L3 (36%) và L1/S/H2 (17%). Sự tương đồng giữa đột biến gen p53 với sự tích tụ quá mức protein P53 trong nhân tế bào là 19%. Tỉ lệ tương đồng giữa biểu hiện protein p53 và tình trạng đột biến gen p53 là 53%. 33 % số mẫu có XN HMMD dương tính có sự biến đổi trình tự gen p53 và 68% số mẫu biến đổi gen p53 có XN HMMD dương tính. Liên quan của biểu hiện protein P53 và đột biến gen p53 với các đặc điểm của carcinôm tuyến vú như nhóm tuổi, loại mô học, độ mô học, và tình trạng hạch đều không có sự khác biệt. Kết luận: Tỷ lệ biểu hiện tích tụ protein P53 trong nhân tế bào carcinôm tuyến vú (IHC) là 57% và tỉ lệ đột biến gen p53 qua kỹ thuật giải trình tự là 28%. Tỷ lệ tương đồng giữa biểu hiện protein p53 và tình trạng đột biến gen p53 là 53%. 33 % số mẫu có XN HMMD dương tính có sự biến đổi gen p53 và 68% số mẫu có biến đổi gen p53 có XN HMMD dương tính. Từ khóa: Đột biến gen, biểu hiện gen, P53, carcinôm tuyến vú. * Đại học Y Dược TP Hồ Chí Minh Tác giả liên lạc: Ts.BS. Đỗ Thị Thanh Thủy. ĐT: 0908.487.425 Email: thuyprenatal@gmail.com Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 100 ABSTRACT DETECTING P53 GENE MUTATIONS OF BREAST CANCER BY IMMUNOHISTOCHEMISTRY AND DIRECT SEQUENCING TECHNIQUES Do Thi Thanh Thuy, Hoang Anh Vu, Hua Thi Ngoc Ha, Nguyen Sao Trung * Y Hoc TP. Ho Chi Minh * Vol. 15 - Supplement of No 2 - 2011: 98 - 106 Background: Breast cancer is the third leading cancer on the world. The incidence and the mortality rates vary depending on countries. Breast cancer is associated with types of somatic genetic alterations such as mutations in tumor suppressor genes and oncogenes. Environmental agents have also affected to etiology of breast cancer. Now, studies have paid attention on gene mutations, especially p53 gene mutations. Some studies assessing the prognostic and predictive roles of p53 alterations in breast cancer have conflicting results. Many studies try to identify the stages which breast cancer’s development and progression occur involving in mutations of p53 gene in somatic cells. Dectecting the pattern of p53 gene mutations in breast cancer by DNA sequencing and immunohistochemistry methods may be help to assess the correlation between p53 gene mutations and p53 protein accumulation, the prognosis the survival as well as having suitable treatment for patients. Aims: - Identify the rate of p53 gene mutations (from exon 5 to exon 8) and p53 protein accumulation in the tissues of breast diagnosed adenocarcinoma by immunohistochemistry and DNA sequencing. - Determine the correlation between p53 gene mutations and p53 protein accumulation in cell nuclei. Method: Cross Sectional Study on 100 patients who were diagnosed adenocarcinoma of breast at University of Medicine and PharcmacyDepartment of Pathology, HCMC from June 2008 to June 2010. Using Immunohistochemistry and DNA sequencing methods to identify p53 protein accumulation and mutations of p53 gene. Analysis of correlation between p53 gene mutations and p53 protein accumulation in cell nuclei. Results: Overexpressions of p53 protein is 57% and p53 gene mutations is 28% inwhich mutations in exon 5 has highest rate with 69,4%. Missense mutations has rate of 91,6%. Mutated sites usually occufy at number 1 and number 2 of codon. 33% mutations is in conserved region and 25% in CpG region. Mutation at codon 175 is 5,6% and mutation at codon 163 (Tyr163Cys) is 14%. Mutation at L2/L3 region is 36$ and L1/S/H2 region is 17%. The rate of the samples with both p53 gene mutated and overexpression of p53 protein is 19%. The correlation between p53 gene mutation status and p53 protein accummulation status is 53%. 33% of samples which have IHC (+) has p53 gene mutation and 68% of samples which have p53 gene mutation has IHC (+). The relation between IHC (+), p53 gene mutation and the characteristics od breast cancer such as age group,types of histology, histological grade and nodular status are not significantly diffirent. Conclusion: Over expressions of p53 protein is 57% and p53 gene mutations is 28%. The correlation between p53 gene mutatin and p53 protein accummulation is: 33% of samples which have IHC (+) has p53 gene mutation and 68% of samples which have p53 gene mutation has IHC (+). Key words: gene mutation, gene expression, p53, adenocarcinoma of breast. ĐẶT VẤN ĐỀ Ung thư vú đứng hàng thứ nhất trong các loại ung thư ở Việt Nam. Tỉ lệ mắc bệnh và tỉ lệ tử vong thay đổi tùy từng quốc gia. Mỗi năm có hơn 1.000.000 trường hợp mới mắc bệnh được chẩn đoán. Mặc dù tỉ lệ mắc bệnh tăng trong vòng 20 năm qua, nhưng tiên lượng của bệnh được cải thiện nhiều vì được chẩn đoán sớm và điều trị tích cực chống lại tình trạng di căn hệ thống. Ung thư vú liên quan đến nhiều loại biến đổi di truyền khác nhau ở tế bào sinh dưỡng, như đột biến ở gen sinh khối u và gen ức chế khối u. Ngoài ra, yếu tố môi trường tác động lên bệnh căn của ung thư vú. Ngày nay, trong ung thư vú, các đột biến gen được nghiên cứu nhiều nhất là ở gen ức chế khối u p53 với tỉ lệ gặp Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 101 khoảng 30%. Một số nghiên cứu đánh giá vai trò của đột biến gen p53 trong tiên lượng bệnh ung thư vú đã gây nhiều tranh cãi. Nhiều nghiên cứu cũng đã cố gắng nhận diện giai đoạn phát sinh ung thư vú mà tại đó đột biến p53 ở các tế bào sinh dưỡng xảy ra. Hai phương pháp phân tích đột biến gen p53 là giải trình tự gen p53 và hóa mô miễn dịch (IHC) xem xét sự biểu hiện protein p53. Trong phạm vi đề tài này, chúng tôi thực hiện giải trình tự gen p53 từ exon 5-8 là vùng tập trung tỉ lệ đột biến cao nhất, đồng thời phân tích sự biểu hiện protein p53 ở các bệnh nhân này bằng phương pháp hóa mô miễn dịch (IHC). ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP Đối tượng nghiên cứu 100 bệnh nhân được chẩn đoán carcinôm tuyến vú tại Bộ Môn Giải Phẫu Bệnh Đại Học Y Dược trong khoảng thời gian từ tháng 06/2008 đến tháng 6/2010 với đầy đủ hồ sơ bệnh án. Phương pháp nghiên cứu Kỹ thuật hoá mô miễn dịch về sự biểu hiện của protein P53 Bệnh phẩm Mẫu mô carcinôm tuyến vú được cố định trong formol đệm trung tính từ 6 – 48 giờ và vùi trong paraffin. Kháng thể được sử dụng Kháng thể DO-7 của nhà sản xuất DakoCytomation, Đan Mạch, với độ pha loãng 1/25. Đọc kết quả và đánh giá dưới kính hiển vi quang học Về sự biểu hiện tích tụ quá mức protein TP53, dựa vào tỷ lệ % nhân tế bào bắt màu và đậm độ bắt màu: 0 (không bắt màu hoặc <10% bắt màu); 1(+) (bắt màu nhạt > 10%); 2(+): (bắt màu trung bình > 10%); 3(+): bắt màu đậm > 10%; Âm tính: 0; Dương tính: 1(+), 2(+), 3(+) với chứng dương là mô carcinôm tuyến vú có mức biểu hiện protein P53 đã biết dương tính (3+) trước đó và chứng âm là không phủ kháng thể thứ nhất. Kỹ thuật giải trình tự phát hiện đột biến gen P53 Tách chiết DNA từ bệnh phẩm Thu hoạch tế bào từ mô vùi nến bệnh phẩm carcinôm tuyến vú. Sau khi đã được chẩn đoán giải phẫu bệnh, vùng mô ung thư được đánh dấu trên tiêu bản HE. Đối chiếu với tiêu bản HE, đánh dấu vùng mô ung thư trên tiêu bản trắng và lấy vùng tế bào ung thư vào tube ly tâm 1,5ml. Tách chiết DNA từ mô CRC bằng QIAkit PCR khuyếch đại đoạn gen p53 chứa exon 5-8: Dùng cặp mồi p53g5F2 5’- GGTTGCAGGAGGTGCTTACA-3’ và p53g8R5’- GTGCTAGGAAAGAGGCAAGG-3 để khuyếch đại đoạn DNA chứa các exon 5-8 có kích thước 1741bp từ hệ gen DNA đã li trích. Thành phần phản ứng: 5 µl 10X PCR buffer, 5 µl 2,5 mM dNTP, 2,5 µl p53g5F2 (10µM), 2,5 µl p53g8R (10µM), 0,3 µl Takara Tag TM HS, 2,5 µg DNA. Chương trình PCR : 98 oC x 1 phút, 98 oC x 10 giây, 60 oC x 30 giây, 72 oC x 2 phút (40 chu kì), 72oC x 5 phút. Kiểm tra kích thước sản phẩm PCR trên gel agarose với thang chuẩn Ready-LoadTM 1 Kb Plus DNA Ladder để xác định kích thước của sản phẩm PCR. Tinh sạch sản phẩm PCR Sử dụng kit GFX của QIAgen. PCR trước giải trình tự và kết tủa DNA bằng ethanol Tiến hành PCR giải trình tự các sản phẩm PCR đã tinh sạch trên bằng 1 mồi xuôi hoặc 1 mồi ngược, tạo ra một lượng lớn các đoạn DNA chồng lắp nhau hơn kém nhau 1 nucleotid, có nucleotide cuối cùng gắn 1 chất bắt màu đặc hiệu sẽ phát huỳnh quang dưới đèn laser. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 102 Thành phần phản ứng PCR 4 µl Big Dye terminator V.3.1, 0.3 µl mồi (10 μM), 12,7 μl đệm giải trình tự 1X, 3 μl PCR đã tinh sạch. Các mồi dùng cho giải trình tự P53g5F2-GGTTGCAGGAGGTGCTTACA, P53,5- 6R -CACTGACAACCACCCTTAAC, P53seq7F – GGCCTCCCCTGCTTGCCACA, P53g8R – TGCTAGGAAAGAGGCAAGG. Toàn bộ sản phẩm PCR giải trình tự này được thu lại theo phương pháp kết tủa bằng ethanol và hòa tan tủa DNA trong dung dich TE hay nước cất. Giải trình tự các sản phẩm PCR Mỗi đoạn DNA khoảng 500-600bp được giải trình tự 2 chiều bằng mồi xuôi và mồi ngược trên máy ABI 3100 Genetic Analyser. Kết quả giải trình tự được đọc bằng chương trình Sequencing Analysing v.2.5. Sau đó, dùng phần mềm SeqCap để so với trình tự chuẩn NC_000017.10 trên GenBank, xác định sự biến đổi nucleotid thuộc exon nào, codon nào, là SNP hay đột biến, là đột biến loại nào. Các dữ liệu đột biến được tra cứu theo dữ liệu của IARC, dữ liệu về SNP của gen p53 được tra cứu trên hệ thống dữ liệu của NCBI. KẾT QUẢ VÀ BÀN LUẬN Đặc điểm chung của mẫu nghiên cứu Tuổi Nghiên cứu này khảo sát các bệnh nhân ung thư vú từ 29 đến 74 tuổi, trung bình là 40,5 (± 9,9) tuổi, tập trung chủ yếu ở độ tuổi từ 30-39, chiếm tỉ lệ 51%. Bảng 1. Tuổi của bệnh nhân nhóm nghiên cứu Tuổi 20-29 30-39 40-49 50-59 60-69 ≥ 70 TC Số ca 8 51 29 5 5 2 100 Tỉ lệ % 8% 51% 29% 5% 5% 2% 100% Hóa mô miễn dịch Biểu hiện của protein P53 qua kết quả HMMD. Bảng 2. Biểu hiện của protein p53 qua kết quả HMMD Protein p53 Số ca Tỉ lệ 1+ 23 23,0 2+ 8 8,0 3+ 26 26,0 Âm tính 43 43,0 Tổng cộng 100 100,0 Tỉ lệ không tích tụ protein p53 (âm tính) là 43% và tích tụ protein TP53 trong nhân là 57%, tỷ lệ này cao hơn so với các nghiên cứu khác. Zellars và cộng sự đánh giá sự biểu hiện P53 trên 1530 bệnh nhân carcinôm tuyến vú cho thấy tỷ lệ dương tính là 51%(14). Nhiều nghiên cứu khác cho thấy tỉ lệ protein P53 (+) dao động trong khoảng từ 18% - 51% (Bảng 3), nguyên nhân được giải thích chủ yếu là do: sự khác biệt về nhóm tuổi (trước và sau mãn kinh), giai đoạn lâm sàng (có và chưa di căn hạch), và sự khác biệt về độ nhạy của các kháng thể trong kỹ thuật hoá-mô-miễn dịch(10). Bảng 3. So sánh tỷ lệ p53 (+) trong carcinôm tuyến vú với các tác giả khác Tác giả Cỡ mẫu Tỉ lệ protein p53 (+)% Zellar và cộng sự(14) 1530 51 Sjogren và cộng sự(12) 315 20 Thor và cộng sự(13) 994 33 Nghiên cứu này 100 57 Khảo sát sự biến đổi trình tự của gen p53 Tỉ lệ đột biến gen p53 Bảng 4. Tỉ lệ đột biến exon 5, 6, 7, 8 ở gen p53 Đột biến gen p53 (exon 5-8) Số lượng Tỉ lệ % Không đột biến 72 72 Có đột biến 28 28 Tổng 100 100 Bảng 5. Tỉ lệ đột biến gen p53 của các nghiên cứu khác Nhóm nghiên cứu Năm Số mẫu Số lượng đột biến Tỉ lệ đột biến Nghiên cứu này 2010 100 28 28% Jin-Woo Ryu(10) 2000 27 10 37% Alsner J.(1) 2000 315 74 25% IARC (9) 2009 14482 3662 25,3% Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Nghiên cứu Y học Chuyên Đề Giải Phẫu Bệnh 103 Theo bảng 4, tỉ lệ gen p53 bị đột biến trên các exon 5, 6, 7, 8 chiếm tỉ lệ 28%. Cho đến nay, người ta nhận thấy tần xuất xuất hiện đột biến gen p53 ở tất cả các loại ung thư là 50%(6). Còn trong các bệnh nhân ung thư vú, tần xuất đột biến gen p53 được ghi nhận thay đổi từ 15 đến 71%(6,7,10). Sự khác biệt về tần xuất phát hiện đột biến ở các nghiên cứu khác nhau tùy thuộc vào việc tầm soát các nhóm dân số nghiên cứu khác nhau, kỹ thuật khác nhau, hay việc giải trình tự toàn bộ gen 53 hay chỉ nhắm vào vùng exon số 5 đến exon số 8, là nơi có tần suất đột biến cao nhất Theo nhiều nghiên cứu, tỉ lệ đột biến gen p53 gặp khoảng 25-40% trong ung thu vú. Tuy vậy, có nghiên cứu chỉ tìm thấy 2,7% đột biến gen p53. Theo tổng kết của IARC (năm 2009)(9), tỉ lệ đột biến gen p53 gặp trong ung thư vú là 25,3% (bảng 3-5), tương đồng với nghiên cứu của chúng tôi. Vị trí exon bị đột biến Bảng 6. Đột biến ở từng exon 5 – 8 gen p53 Kết quả đột biến Exon 5-8 Số lượng Tỉ lệ % Exon 5 25 69,4% Exon 6 5 13,9% Exon 7 4 11,1% Exon 8 2 5,6% Theo bảng 6, tỉ lệ đột biến gen p53 ở các exon 5, 6, 7, 8 lần lượt là 69%, 14%, 11% và 6%. Tỉ lệ đột biến p53 trên exon 5 xảy ra với tỷ lệ cao nhất (69%). Nhiều tác giả cho rằng đột biến gen p53 nằm chủ yếu ở các exon 5, 6, 7 và 8, tỷ lệ này có thể chiếm từ 80 đến 95%. Đây là vùng có tính bảo tồn cao, là vùng chức năng nơi các protein điều hòa hoạt động gen bám vào và là vùng bám DNA của protein P53. Chính vì vậy trong nghiên cứu này, do kinh phí có hạn, chúng tôi tập trung tìm đột biến gen p53 ở các exon 5-8 trong các mẫu mô vùi nến có kết quả giải phẫu bệnh carcinôm tuyến vú. Tuy nhiên, theo Osborne R.J, tỷ lệ đột biến trên exon 5 dường như không phải cao nhất so với các exon khác trong vùng bảo tồn hay theo Ryu J.W(10), thì tỷ lệ đột biến gen p53 lại gặp ở exon 7 nhiều hơn (70%) khi nghiên cứu trên mẫu ung thư vú ở của phụ nữ Hàn Quốc. Về các vị trí codon bị đột biến Vị trí acid amin đột biến thường gặp nhất là Cys 135, Arg158, Tyr163, Asn239 với tỷ lệ lần lượt là 11%, 14%, 14%, và 6%. Các vị trí acid amin đột biến thường gặp (hotspots) hay nằm trong vùng DNA dễ bị tổn thương (như vị trí cặp nucleotide CpG) hoặc là bộ mã di truyền mã hóa cho một acid amin chủ chốt trong vùng thực hiện chức năng sinh học của protein, hoặc cả hai. Phân bố đột biến ở các codon của gen p53 trong carcinôm tuyến vú tại các vị trí thường gặp tương tự với các loại ung thư khác. Theo Cho(5), các vị trí hotspots lần lượt là Arg175, Gly245, Arg248, Arg249, Arg273, và Arg282 trong tất cả các dạng ung thư. Tuy nhiên, theo Feki(7) đột biến tại codon 163 (TAC thành TGC) chiếm khoảng 2% trong carcinôm tuyến vú, trong khi đó đột biến ở codon này trong các ung thư khác chỉ chiếm khoảng 1%. Ngoài ngoại lệ này, các nghiên cứu trên toàn cầu đều cho thấy sự khác biệt về đột biến gen p53 trong carcinôm tuyến vú và các ung thư khác là không có ý nghĩa. Trong nghiên cứu này, đột biến Arg 175 gặp với tỷ lệ 5,6%. Theo Hamroun(7), đột biến Arg175 là đột biến thường gặp và 90% đột biến này là dạng Arg175 His, còn đột biến trong nghiên cứu của chúng tôi tuy cũng rơi vào vị trí 175, nhưng từ Arg biến đổi thành Cys (2,8%) và Prolin (2,8%). Đột biến này có tính chọn lọc cao trong các bệnh ung thư ở người, là do protein P53 có chức năng cần thiết trong gấp xoắn ở vùng liên kết DNA đồng thời có khả năng đột biến cao của dinucleotid CpG được methyl hoá ở codon này (CGA)(14). Ngoài ra, chúng tôi không gặp các đột biến thường gặp khác như các tác giả nêu trên, tuy nhiên điều lưu ý là có đột biến 163 (Tyr (TAC) thành Cys (TGC)) chiếm Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011 Chuyên Đề Giải Phẫu Bệnh 104 tỷ lệ 14%, và trong 5 trường đột có đột biến Tyr 163 thì có 4 trường hợp đột biến này đi kèm với đột biến Cys 135 Tyr. Ngoài ra, có 5 trường hợp có đột biến tại Arg158 (tỷ lệ 14%), vậy liệu chúng có phải là các đột biến thường gặp trong bệnh nhân carcinôm tuyến vú tiên phát ở người Việt Nam. Tương tự như nghiên cứu của Coles C trên 136 bệnh nhân bị carcinôm tuyến vú với 41 trường hợp có đột biến p53, nhưng tác giả cũng nhận thấy không có đột biến nào được gọi là đột biến thường gặp như một số tác giả khác đã nêu. Như vậy, tỷ lệ đột biến trên các quần thể khác nhau liệu có sự phân bố đột biến trên gen p53 khác nhau? Số lượng đột biến trên một mẫu bệnh phẩm Bảng 7. Số lượng đột biến trên một mẫu bệnh phẩm 2 đột biến/1 mẫu 1 đột biến/1 mẫu 1 exon 2 exon Tổng Số mẫu 20 6 (21%) 2 (8%) 28 Tì lệ % 71% 29% 100% Theo Bảng 7 số mẫu bệnh phẩm vùi nến của một bệnh nhân carcinôm tuyến vú chỉ mang 1 đột biến chiếm tỷ lệ 71%, mang 2 đột biến chiếm 29% (trong đó 2 đột biến trên cùng một exon chiếm 21% và 2 đột biến trên 2 exon chiếm 8%). Andersson(2) cũng tìm thấy có 4,8% khối u có thậm chí 2 loại đột biến khác nhau, vừa đột biến điểm nhầm nghĩa vừa đột biến mất nucleotid hoặc thêm nucleotid. Các kiểu đột biến gen p53 Bảng 8. Phân loại các kiểu đột biến theo vị trí exon trên gen p53 Các dạng biến đổi Exon 5 Exon 6 Exon 7 Exon 8 Số lượng Tỉ lệ % Đột biến thay thế 24 4 4 2 34/36 94,4 Nhầm nghĩa 24 4 4 1 33/36 91,6 Vô nghĩa 0 0 0 1 1/36 2,8 Đột biến dịch khung 1 1 0 0 2/36 5,6 Mất 1 0 0 0 1/36 2,8 Thêm 0 1 0 0 1/36 2,8 Đột biến điểm 25 5 4 2 36/36 100% Tại A 7 0 1 0 8/36 22,2% Tại T 4 3 0 2 9/36 25,0% Tại G 10 1 3 0 14/36 38,9% Tại C 4 1 0 0 5/36 13,9% Đồng hoán 17 3 4 1 25/36 69,4% A→G 6 0 3 0 9 25% G→A 4 1 1 0 6 16,7% C→T 3 0 0 1 4 11,1% T→C 4 2 0 0 6 16,7% Dị hoán 7 1 0 1 9/36 25% A→T 1 0 0 0 1 2,8% G→T 5 0 0 1 6 16,7% G→C 1 0 0 0 1 2,8% T→G 0 1 0 0 1 2,8% Khác 1 1 0 0 2/36 5,6% Vị trí Nu
Tài liệu liên quan