Xác định đột biến exon 2 gen RHOA trên bệnh nhân ung thư dạ dày thể lan tỏa

Ung thư dạ dày thể lan tỏa là type ung thư có xu hướng xâm lấn dẫn đến di căn sớm và tỷ lệ sống thêm thấp. Không giống như ung thư dạ dày thể ruột nơi mà khối u có sự khuếch đại HER2 được điều trị bằng trastuzumab, thì chúng ta thiếu các liệu pháp điều trị đích hiệu quả cho ung thư dạ dày thể lan tỏa. Sự khác biệt này đang dần được làm sáng tỏ khi đột biến gen RHOA- gen mã hoá RhoA GTPase nhỏ được quan sát thấy ở các bệnh nhân ung thư dạ dày thể lan tỏa trong một số nghiên cứu gần đây. Trong nghiên cứu này, chúng tôi tiến hành giải trình tự exon 2 gen RHOA cho 38 bệnh nhân ung thư dạ dày thể lan tỏa nhằm phát hiện đột biến exon 2 gen RHOA. Kết quả cho thấy tần số đột biến RHOA là 5,3% (2/38) với điểm nóng là Tyr42 trong chuỗi protein RHOA. Các đột biến này ảnh hướng đến vùng chức năng và gây nên những thiếu sót trong tín hiệu RHOA, điều khiển quá trình né tránh anoikis trong phát triển bào quan. Những nghiên cứu của chúng tôi có thể giúp tìm ra những liệu pháp điều trị đích đầy tiềm năng cho thể ung thư dạ dày tiên lượng nghèo nàn cũng như không có thuốc điều trị phân tử đích hữu hiệu này.

pdf6 trang | Chia sẻ: thuyduongbt11 | Ngày: 14/06/2022 | Lượt xem: 195 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Xác định đột biến exon 2 gen RHOA trên bệnh nhân ung thư dạ dày thể lan tỏa, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
32 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC Địa chỉ liên hệ: Đặng Thị Ngọc Dung, Bộ môn Hóa Sinh, Trường Đại học Y Hà Nội. Email: ngoczung@hmu.edu.vn Ngày nhận: 24/9/2018 Ngày được chấp thuận: 22/10/2018 XÁC ĐỊNH ĐỘT BIẾN EXON 2 GEN RHOA TRÊN BỆNH NHÂN UNG THƯ DẠ DÀY THỂ LAN TỎA Đặng Thị Nga, Nguyễn Thị Ngọc Lan, Tạ Thành Văn, Đặng Thị Ngọc Dung Trường Đại học Y Hà Nội Ung thư dạ dày thể lan tỏa là type ung thư có xu hướng xâm lấn dẫn đến di căn sớm và tỷ lệ sống thêm thấp. Không giống như ung thư dạ dày thể ruột nơi mà khối u có sự khuếch đại HER2 được điều trị bằng trastuzumab, thì chúng ta thiếu các liệu pháp điều trị đích hiệu quả cho ung thư dạ dày thể lan tỏa. Sự khác biệt này đang dần được làm sáng tỏ khi đột biến gen RHOA- gen mã hoá RhoA GTPase nhỏ được quan sát thấy ở các bệnh nhân ung thư dạ dày thể lan tỏa trong một số nghiên cứu gần đây. Trong nghiên cứu này, chúng tôi tiến hành giải trình tự exon 2 gen RHOA cho 38 bệnh nhân ung thư dạ dày thể lan tỏa nhằm phát hiện đột biến exon 2 gen RHOA. Kết quả cho thấy tần số đột biến RHOA là 5,3% (2/38) với điểm nóng là Tyr42 trong chuỗi protein RHOA. Các đột biến này ảnh hướng đến vùng chức năng và gây nên những thiếu sót trong tín hiệu RHOA, điều khiển quá trình né tránh anoikis trong phát triển bào quan. Những nghiên cứu của chúng tôi có thể giúp tìm ra những liệu pháp điều trị đích đầy tiềm năng cho thể ung thư dạ dày tiên lượng nghèo nàn cũng như không có thuốc điều trị phân tử đích hữu hiệu này. Từ khóa: Ung thư dạ dày thể lan tỏa, gen RHOA I. ĐẶT VẤN ĐỀ Ung thư dạ dày là một trong các loại ung thư phổ biến nhất trên thế giới và đứng hàng đầu trong các ung thư đường tiêu hóa [1]. Ung thư dạ dày được Lauren chia thành 2 thể mô bệnh học riêng biệt là thể ruột và thể lan tỏa với sự khác biệt rõ rệt về dịch tễ, bệnh nguyên và đặc biệt là tiên lượng [2; 3]. Thể lan tỏa có xu hướng xâm lấn chuyển thành di căn sớm và có tiên lượng xấu hơn. Hơn nữa, không giống như trong thể ruột, nơi các khối u tăng cường biểu hiện HER2 được điều trị hiệu quả bằng Trastuzumab, hiện nay chúng ta đang thiếu các phương pháp điều trị đích hiệu quả cho bệnh nhân thể lan tỏa [4; 5]. Sự khác biệt này đang dần được làm sáng tỏ khi đột biến gen CDH1-gen mã hóa E-cadherin được phát hiện ở các bệnh nhân ung thư dạ dày lan tỏa có tính chất gia đình và đột biến gen RHOA - gen mã hoá RhoA GTPase nhỏ được quan sát thấy ở các bệnh nhân ung thư dạ dày thể lan tỏa [6 - 10]. Gen RHOA nẳm trên nhánh ngắn nhiễm sắc thể số 3, mã hóa protein RhoA GTPase đóng vai trò quan trọng trong sự di chuyển, kết dính, sự sống sót, phân chia của tế bào và sự biểu hiện gen. RHOA ban đầu được mô tả như một gen sinh ung thư vì sự tăng cường biểu hiện nó dẫn đến chuyển dạng ác tính và hình thành khối u trong in vivo [11; 12]. Trong thực tế, tăng cường biểu hiện của gen RHOA được quan sát thấy ở nhiều bệnh lý ác tính và thường liên quan đến sự tiến triển của nhiều loại ung thư như ung thư vú, u Lympho, ung thư gan nguyên phát, ung thư đại trực tràng [13; 14]. Một số nghiên cứu gần đây nhận thấy đột biến gen RHOA xuất hiện một cách đặc hiệu trong ung thư dạ dày thể lan tỏa và gợi ý rằng đây có thể là một phân tử đích đầy tiềm TCNCYH 115 (6) - 2018 33 TẠP CHÍ NGHIÊN CỨU Y HỌC năng để điều trị thể ung thư dạ dày có tiên lượng xấu này [15; 16]. Tại Việt Nam hiện chưa có nghiên cứu nào về đột biến gen RHOA ở bệnh nhân ung thư dạ dày thể lan tỏa, vì vậy chúng tôi tiến hành nghiên cứu với mục tiêu: Xác định đột biến exon 2 gen RHOA trên bệnh nhân ung thư dạ dày thể lan tỏa. II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP 1. Đối tượng 38 bệnh nhân được chẩn đoán xác định ung thư dạ dày thể lan tỏa theo phân loại Lau- ren 1965 dựa trên mô bệnh học tại bệnh viện K cơ sở Tân Triều, Bệnh viện 108 và Bệnh viện Đại học Y Hà Nội được đưa vào nghiên cứu từ tháng 06/2017 đến tháng 06/2018. Các bệnh nhân được xác định đột biến exon 2 gen RHOA tại Trung tâm Kiểm chuẩn chất lượng Y học, Trường Đại học Y Hà Nội. 2. Phương pháp 2.1. Tiêu chuẩn chẩn đoán ung thư dạ dày thể lan tỏa Bệnh nhân được chẩn đoán ung thư dạ dày thể lan tỏa theo phân loại mô bệnh học của Lauren 1965: gồm những mảng tế bào dạng thượng bì hoặc những tế bào rải rác trong chất căn bản mô đệm không có bằng chứng tạo tuyến, không có tính kết dính. Ung thư thể lan tỏa có thể gồm các tế bào nhẫn, lan rộng theo lớp dưới niêm mạc, ít thâm nhập tế bào viêm, thường có mức độ biệt hóa kém. 2.2. Tiêu chuẩn lựa chọn và loại trừ - Tiêu chuẩn lựa chọn: + Tuổi ≥ 18 tuổi. + Bệnh nhân được chẩn đoán xác định ung thư dạ dày nguyên phát với mô bệnh học thuộc type lan tỏa theo phân loại Lauren 1965. + Tình nguyện tham gia vào nghiên cứu. - Tiêu chuẩn loại trừ: + Bệnh nhân, gia đình bệnh nhân không đồng ý tham gia nghiên cứu. + Không đủ hồ sơ và thông tin bệnh nhân ở thời điểm kết thúc nghiên cứu. 2.3. Lấy mẫu Mẫu mô ung thư dạ dày lan tỏa sinh thiết đúc trong khối nến được thu thập sau khi bệnh nhân được chẩn đoán xác định dựa vào kết quả mô bệnh học. 2.4. Kỹ thuật tách chiết DNA Các mẫu mô được lựa chọn vùng tập trung tế bào ung thư (tại Khoa Giải phẫu bệnh) bằng cách đánh dấu vùng mô ung thư để phân biệt với vùng mô lành xung quanh. Các mẫu DNA được tách chiết từ mẫu mô farafin theo QIAamp ADN Mini Kit (QIAGEN, Đức). Nồng độ và độ tinh sạch DNA được kiểm tra nhờ phương pháp quang phổ (OD 260/280). 2.5. Kỹ thuật PCR - Phản ứng PCR khuếch đại exon 2 gen RHOA sử dụng cặp mồi: + Mồi xuôi: GGATCGGCGTACTAGAAGTTTG + Mồi ngược: ACATGGAAAATGGCAT- CAGTTGTT. - Thành phần phản ứng PCR (thể tích 25 µl): 12.5 µl Hotstart, 0.5 µl mồi xuôi, 0.5 µl mồi ngược, 1 µl DNA và 10.5 µl H2O. - Chu trình nhiệt phản ứng PCR: 950C/5 phút, 40 chu kỳ [950C/30 giây, 600C/30 giây, 720C/30 giây], 720C/5 phút. - Bảo quản mẫu ở: 100C. 34 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC 2.6. Tinh sạch DNA Sản phẩm PCR được tinh sạch bằng phương pháp Ethanol precipitation. 2.7. Kỹ thuật giải trình gen trực tiếp Sản phẩm PCR sau khi tinh sạch được tiến hành giải trình tự trược tiếp trên máy ABI se- quencer 3500. Kết quả được thu thập và sử lý bằng phần mềm BioEdit 7.2.6 và ApE-A plas- mid Editor 2.0.3. Trình tự được so sánh trên GeneBank để phát hiện đột biến DNA (NG_051308.1), mRNA (NM_001313941.1). 3. Đạo đức nghiên cứu Nghiên cứu này đã được chấp thuận của hội đồng đạo đức trong nghiên cứu Y sinh học Trường Đại học Y Hà Nội, số 198/HĐĐĐĐHYHN ngày 21 tháng 9 năm 2016. Các đối tượng tham gia hoàn toàn tự nguyện và có quyền rút khỏi nghiên cứu khi không đồng ý tiếp tục tham gia. Các thông tin liên quan đến bệnh nhân được đảm bảo bí mật. III. KẾT QUẢ 1. Kết quả khuếch đại exon 2 gen RHOA Sử dụng cặp mồi đặc hiệu cho exon 2 gen RHOA để khuếch đại DNA tách từ mẫu mô farafin. Kết quả hình 1 cho thấy, sản phẩm PCR thu được chỉ có 1 băng đặc hiệu, rõ nét, kích thước 307 bp, không có sản phẩm phụ. Sản phẩm PCR đảm bảo phản ứng giải trình tự tiếp theo để phát hiện đột biến. Hình 1. Hình ảnh điện di sản phẩm PCR khuếch đại exon 2, gen RHOA M: marker; (-) chứng âm; (+): chứng dương, 1 - 7: mẫu bệnh nhân. 2. Kết quả xác định đột biến exon 2 gen RHOA Tiến hành xác định đột biến bằng kỹ thuật giải trình tự exon 2 gen RHOA. Bảng 1. Kết quả đột biến exon 2 gen RHOA của bệnh nhân ung thư dạ dày thể lan tỏa 307 bp M 1 2 3 4 5 6 7 (+) (-) MS Thay đổi c.DNA Thay đổi acid amin Tài liệu công bố 4249 c.36634 A > G Tyrocine 42 Cysteine (Y42C) Kakiuchi (2014) [8] Wang(2014) [9] 65360 c.36634 A > G Tyrocine 42 Cysteine (Y42C) Kết quả đã phát hiện được 2/38 (5,3%) có đột biến điểm trên exon 2 gen RHOA. Cả hai đột TCNCYH 115 (6) - 2018 35 TẠP CHÍ NGHIÊN CỨU Y HỌC biến đều là đột biến sai nghĩa (missense mutation). Tại vị trí 36634 trên phân tử mRNA của gen RHOA tương ứng với nucleotid A ở người bình thường đã được thay thế bằng nucleotid G dẫn đến sự thay đổi acid amin Tyrocine ở vị trí 42 thành Cystein. Hình 2. Kết quả giải trình tự gen của bệnh nhân 65360 IV. BÀN LUẬN Ung thư dạ dày thể lan tỏa được đặc trưng bởi sự mất kết dính giữa các tế bào nên có xu hướng di căn sớm, là một thể ác tính với mức độ biệt hóa kém và có tiên lượng xấu ở hai giới. Ở Việt Nam, hàng năm một số lượng lớn người bị bệnh và thường đến viện ở giai đoạn muộn với nhiều tổn thương phức tạp và biến chứng nặng nề. Tuy nhiên, hầu hết các nghiên cứu mới chỉ đề cập về tỷ lệ mắc bệnh, biểu hiện lâm sàng, kết quả điều trị và các biến chứng của bệnh. Việc phát hiện đột biến gen RHOA ở bệnh nhân ung thư dạ dày thể lan tỏa nhưng lại hiếm khi quan sát thấy ở các type ung thư dạ dày khác có thể làm cơ sở đầy tiềm năng triển khai liệu pháp điều trị đích hướng đến những bệnh nhân có HER2 âm tính. Đột biến gen RHOA chủ yếu nằm trên hai exon 2 và 3. Vì vậy nghiên cứu này bước đầu tiến hành giải trình tự ở exon 2 là vùng có đột biến thường gặp trên gen RHOA. Nghiên cứu đã phát hiện được 2/38 (5,3%) bệnh nhân mang đột biến trên exon 2 gen RHOA, cả hai đều là đột biến Tyr42Cys. Tỷ lệ này thấp hơn so với nghiên cứu của Wang khi tỉ lệ đột biến trên exon 2 là 13,3% và tỷ lệ đột biến của hotspot Tyr42Cys là 4,1%, theo Kakiuchi thì tỷ lệ này lần lượt là 18,4% (16/87) và 6,9% (6/87) [8; 9]. Đây là loại đột biến nằm ở vị trí gắn GTP, ảnh hưởng sau sắc đến hoạt động của chính bản thân protein, làm mất khả năng gắn GTP. Wang và cộng sự nhận thấy RHOA đột biến Tyr42Cys khiến tế bào thoát khỏi quá trình anoikis (một dạng đặc biệt của apoptosis) trên mô hình nuôi cấy mô ruột non ở chuột có thể liên quan đến đặc trưng hình thái của type lan tỏa. Kakiuchi cũng đã chứng minh ảnh hưởng thúc đẩy sự tăng trưởng của các đột biến RHOA Tyr42Cys trên dòng tế bào bị đột biến RHOA (SW948). Tất cả các đột biến này đều ở dạng dị hợp tử, điều này có thể giải thích bệnh nhân mang đột biến dù ở dạng dị hợp tử nhưng ở các vùng chức năng có thể ảnh hưởng sâu sắc đến quá trình phát triển của bệnh. Tần suất mắc các đột biến này là khác nhau ở các quốc gia và các nghiên cứu khác nhau, tuy nhiên đều có một đặc điểm chung rằng đột biến Tyr42Cys là các hotspots đang 36 TCNCYH 115 (6) - 2018 TẠP CHÍ NGHIÊN CỨU Y HỌC được chú ý nhiều nhất trong nghiên cứu gen RHOA ở bệnh nhân ưng thư dạ dày thể lan tỏa. V. KẾT LUẬN Đã phát hiện được 2/38 bệnh nhân có đột biến dị hợp tử Tyr42Cys trên exon 2 gen RHOA. Đây là các đột biến hotspot có tính chất quyết định trong chức năng của gen và đã được nhiều nghiên cứu đề cập tới. Tuy nhiên, để hiểu cặn kẽ hơn về cơ chế bệnh sinh của RHOA trong ung thư dạ dày thể lan tỏa cần các nghiên cứu với cỡ mẫu lớn hơn nữa và nghiên cứu chuyên sâu hơn nữa. Lời cảm ơn Nghiên cứu này được tài trợ bởi Quỹ Phát triển khoa học và công nghệ Quốc gia (NAFOSTED) trong đề tài mã số 106-YS.02- 2015.37. Nhóm nghiên cứu xin chân thành cảm ơn những bệnh nhân đã đồng ý tham gia nghiên cứu. TÀI LIỆU THAM KHẢO 1. WHO (2014). World Cancer Report 2014. 2. Lauren P (1965). The two histological main types of gastric carcinoma: diffuse and so-called intestinal-type carcinoma. An at- tempt at a histo - clinical classification. Acta Pathol Microbiol Scand, 64, 31 - 49. 3. Lazăr D., Tăban S., Sporea I et al (2009). Gastric cancer: Correlation between clinicopathological factors and survival of pa- tients. Romanian Journal of Morphology and Embryology, 50(2), 185 - 194. 4. Bang Y.J., Van Cutsem E., Feyereis- lova A et al (2010). Trastuzumab in combina- tion with chemotherapy versus chemotherapy alone for treatment of HER2-positive ad- vanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, ran- domised controlled trial. Lancet, 376(9742), 687 - 697. 5. Jin Zhou., Yoku Hayakawa., Timothy C. Wang et al (2014). RhoA Mutations Identi- fied in Diffuse Gastric Cancer. Cancer Cell, 26 (1), 9 - 11. 6. Guilford P., Hopkins J., Harraway J et al (1998). E-cadherin germline mutations in familial gastric cancer. Nature, 392(6674), 402 - 405. 7. Ina Chen., Lesley Mathews‑Greiner., Dandan Li et al (2017). Transcriptomic profil- ing and quantitative high-throughput (qHTS) drug screening of CDH1 deficient hereditary diffuse gastric cancer (HDGC) cells identify treatment leads for familial gastric cancer. Journal of Translational Medicine, 15(1), 1 - 16. 8. Kakiuchi M., Nishizawa T., Ueda H.,et al (2014). Recurrent gain-of- function muta- tions of RHOA in diffuse-type gastric carci- noma. Nature genetics, 46(6), 583 - 587. 9. Wang K., Yuen S.T., Xu J et al (2014). Whole-genome sequencing and comprehen- sive molecular profiling identify new driver mu- tations in gastric cancer. Nature genetics, 46 (6), 573 - 582. 10. TCGA (2014). Comprehensive molecu- lar characterization of gastric adenocarci- noma. Nature, 513(7517), 202 - 209. 11. Yoshizaki H., Ohba Y., Kurokawa K et al (2003). Activity of Rho- family GTPases during cell division as visualized with FRET- based probes. J Cell Biol, 162(2), 223 - 232. 12. Kathleen O'Connor., Min Chen (2013). Dynamic functions of RhoA in tumor cell migration and invasion. Small GTPases, 4 (3), 141 - 147. 13. Sakata-Yanagimoto M., Enami T., Yoshida K et al (2014). Somatic RHOA muta- TCNCYH 115 (6) - 2018 37 TẠP CHÍ NGHIÊN CỨU Y HỌC tion in angioimmunoblastic T cell lymphoma. Nat Genet, 46(2), 171 - 175. 14. Hu T., Guo H., Wang W et al (2013). Loss of P57 Expression and RhoA Overex- pression Are Associated With Poor Survival of Patients With Hepatocellular Carcinoma. On- col Rep, 30(4), 1707 - 1714. 15. Masahiro Maeda., Toshikazu Ushi- jima (2016). RHOA mutation may be associ- ated with diffuse-type gastric cancer progres- sion, but is it gain or loss? Gastric Cancer, 19 (2), 326 - 328. 16. Ushiku T., Ishikawa S., Kakiuchi M et al (2016). RHOA mutation in diffuse-type gas- tric cancer: a comparative clinicopathology analysis of 87 cases. Gastric Cancer, 19(2), 403 - 411. Summary MUTATE EXON 2 GENE RHOA IN DIFFUSE GASTRIC CANCER The propensity of diffuse gastric cancer for invasion translates into early metastasis and poor survival. Unlike in IGC where tumors with HER2-amplification are treated with trastuzumab, we lack effective targeted therapies for DGC. This difference is gradually being clarified as mutations of RHOA - encoding the small GTPase RhoA have been observed in DGC patients in recent studies. In this study, we performed exon 2 RHOA sequencing on 38 DGC cases to detect muta- tions at exon 2 RHOA gene. The results showed that RHOA mutations occurs in 5.3% (2/38) of diffuse-type tumors with mutational hotspot Tyr42 in RHOA protein. The hotspot affected the func- tional domains resulting in defective RHOA signaling and promoting escape from anoikis in organ- oid cultures. Our findings identify a potential therapeutic target for this poor-prognosis subtype of gastric cancer with no available molecularly targeted drugs. Keywords: RHOA, diffuse gastric cancer
Tài liệu liên quan